Issatchenkia orientalis Kudrjanzev, teleomorph (ATCC® 6258)

Alternate State: Candida krusei (Castellani) Berkhout, anamorph  /  Strain Designations: [ATCC 749, CBS 573, CCRC 20514, IFO 1064, IFO 1395, JCM 1609, NRRL Y-413, NRRL Y-7179]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Candida krusei (Castellani) Berkhout, anamorph
Strain Designations [ATCC 749, CBS 573, CCRC 20514, IFO 1064, IFO 1395, JCM 1609, NRRL Y-413, NRRL Y-7179]
Alternate State Candida krusei (Castellani) Berkhout, anamorph
Application
Assay of itraconzaole
Assay of ketoconazole
Quality control
Quality control strain
Sterility testing
Susceptibility disc testing
Susceptibility testing
Quality control strain for API products
Antifungal susceptibility testing
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain yes
Comments
Esterase activity
RAPD profiles
Morphology After 4 days on Potato dextrose medium at 37°C, colony is white, smooth and soft. Cells are ovoid to cylindrical, single, in pairs or chains, pseudohyphae are absent.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAG

 

D1D2 region of the 26S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTTTGCGGCACGAGTTGTAGATTGCAGGTTGGAGTCTGTGTGGAAGGCGGTGTCCAAGTCCCTTGGAACAGGGCGCCCAGGAGGGTGAGAGCCCCGTGGGATGCCGGCGGAAGCAGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGCGCCCGACATGGGGATTGCGCACCGCTGCCTCTCGTGGGCGGCGCTCTGGGCTTTCCCTGGGCCAGCATCGGTTCTTGCTGCAGGAGAAGGGGTTCTGGAACGTGGCTCTTCGGAGTGTTATAGCCAGGGCCAGATGCTGCGTGCGGGGACCGAGGACTGCGGCCGTGTAGGTCACGGATGCTGGCAGAACGGCGCAACACCG

Morphology After 4 days on Potato dextrose medium at 37°C, colony is white, smooth and soft. Cells are ovoid to cylindrical, single, in pairs or chains, pseudohyphae are absent.
Name of Depositor A Castellani
Isolation
Sputum of patient with bronchomycosis, Sri Lanka
Cross References

Nucleotide (GenBank) : AX109706 Sequence 439 from Patent WO0123604.

Nucleotide (GenBank) : M60305 C. krusei small subunit ribosomal RNA.

Nucleotide (GenBank) : S75391 cytochrome P-450 lanosterol-alpha-demethylase [Issatchenkia

Nucleotide (GenBank) : AF250036 Issatchenkia orientalis strain ATCC 6258 ABC transporter Abc1p

Nucleotide (GenBank) : AF250037 Issatchenkia orientalis strain ATCC 6258 ABC transporter Abc2p

References

Rudek W. Esterase activity in Candida species. J. Clin. Microbiol. 8: 756-759, 1978. PubMed: 370150

Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J. Med. Vet. Mycol. 34: 293-297, 1996. PubMed: 8873891

Castellani AJ. Note on the importance of hyphomycetes and other fungi in tropical pathology. Br. Med. J. 2: 1208-1212, 1912.

Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J. Clin. Microbiol. 32: 1625-1628, 1994. PubMed: 7929747

Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J. Clin. Microbiol. 32: 1650-1653, 1994. PubMed: 7929752

Espinel-Ingroff A, et al. Comparison of two alternative microdilution procedures with the National Committee for Clinical Laboratory Standards reference macrodilution method M27-P for in vitro testing of fluconazole-resistant and -susceptible isolates of Candida albicans. J. Clin. Microbiol. 33: 3154-3158, 1995. PubMed: 8586692

Rex JH, et al. Quality control guidelines for National Committee for Clinical Laboratory Standards--recommended broth macrodilution testing of ketoconazole and itraconazole. J. Clin. Microbiol. 34: 816-817, 1996. PubMed: 8815089

Davey KG, et al. Comparative evaluation of FUNGITEST and broth microdilution methods for antifungal drug susceptibility testing of Candida species and Cryptococcus neoformans. J. Clin. Microbiol. 36: 926-930, 1998. PubMed: 9542910

Sensititre YeastOne. Thermo Scientific Sensititre Systems, Trek Diagnostic Systems.

Quality Control MIC Limits for Broth Microdilution Informational Supplement. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M27-S3.

Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2.

Supplemental assay method for testing growth promoting qualities of fluid thioglycollate medium and soybean-casein digest medium using Bacillus Subtilis spores and Candida krusei as the indicator organisms. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0900.01, 1999

Supplemental assay method for testing growth-promoting qualities of brain heart infusion agar using Bacillus subtilis spores and Candida krusei as indicator organisms. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0902.01, 1999

Supplemental assay method for testing for preservative interference with sterility tests. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0903.01, 1999

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

VITEK 2 Antifungal AST Card. bioMerieux.

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

VITEK 2 AST-YS QC Set. bioMerieux.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation