Kloeckera japonica Saito et Ohtani (ATCC® 58370)

Alternate State: Hanseniaspora valbyensis Klocker, teleomorph  /  Strain Designations: NRRL Y-1382 [CBS 281]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL Y-1382 [CBS 281]
Alternate State Hanseniaspora valbyensis Klocker, teleomorph
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GCGGAAGGATCATTAGATTGAATTATCATTTTGTTGCTCGAGTTCTTTTAAGATCTTTTACAATTTAAATGGGTTGTCTTTGTTTGAGATGTGCGCTTAATTGCGCTGCTTATTCAGAGGCTCTCAGTAGAAGTAATTTTTAATTGAATCTCAGTCAACTACTACACACAGTGGAGTTTTCTACTTAATTCTTTCTACTTTGGGTCGCAAGATCCAAGGTAAAAACAAACACAAACAATTTTTTTTATTATAATTTTTTAAGCTAAACCAAAATTCCTAACGGAAATTTTAAATAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCGAATTGCGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTGAATTTTTGAACGCACATTGCGTCCTCAGGTATTCCTGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAAAGAATATTTTATTATTTTTTTGGTAGTGAGCGATACTCAGGGTTAGCTTGAAATTGAAGATTTTTGTAATCTTTAATAATTCAACACTTAGCTTCTTTGGAGACGCTGTTCTCGCTGTGATGTATTTATGGATTCGTCTATTTTTTACATTTGCAAGGGATTCGGTAAAGTACCTTAGGCAAAGAGTTGTTTTTAATACTCATCAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATA

Name of Depositor NRRL
Isolation
Tree exudate; Japan
References

Saito K. On some fermentative yeasts isolated from sap exuded from tree trunks. J. Ferment. Technol. 9: 6-11, 1931.

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation