Candida geochares (van der Walt et al.) Meyer et Yarrow, anamorph (ATCC® 36852)

Strain Designations: CBS 6870 [CCRC 22394, IFO 10278, NRRL Y-17073]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Torulopsis geochares van der Walt et al., anamorph
Strain Designations CBS 6870 [CCRC 22394, IFO 10278, NRRL Y-17073]
Application
quality control strain
Biosafety Level 1
Product Format freeze-dried
Type Strain yes (type strain)
Morphology

After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 µm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin.

Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 26.0°C
Sequenced Data

18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGTAGGTGAACCTGCGGAAGGATCATTTCTGAATCTTCTACACACAGTGACACGAACAAGTGACGCGCAGCGGCACTTGTGATTGCTTCCGGTTCGCCGGGCTTTAACAACAACCAAATTAATCTGACAACGAAAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTGCGCCAGTTTACTGGCATACTGCGTTGAGCGTCGGCCTTCCTCCACAGGTAATGCTACTTTCAGTAGTTAAAGGCATGGAAATGCACCCGTTAGCAAAACGGTGCACACCACAAAAATTCGACCTCAGCGTAGTAAGATTACCCGCTGAACTTAAG

Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAATGGCGAATGAACAGGCAAAAGCTCAGATTTGAAACCCTCGGGATTGTAATCTGAAGACCTGGATTTGGCAGGCTGACCAAGTCTTCTGGAATGGAGCGCCATGGAGGGTGACAGCCCCGTAGCAGCAGCCATTGTAAATCCGGGTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATGCTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAATGGAAGGCAATGAGGTGCGATTGAACCGGACGTTTGCGGGCAGGACAAAAGCGCAGGCCGCCTCGGCATTGCCTGCGTGCATACTGCCTCGCGGACTACCAGTTCTAACAACGCCTTATTGCAC

Morphology

After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 µm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin.

Name of Depositor CBS
Chain of Custody
ATCC <<--CBS<<--J.P. van der Walt
Isolation
grassland soil, South Africa
References

van der Walt JP, et al. Torulopsis geochares and Torulopsis azyma, two new haploid species of ascomycetous affinity. Antonie van Leeuwenhoek 44: 97-104, 1978. PubMed: 566080

type strain

YT MicroPlate. Biolog.

type strain

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation