Candida kefyr (Beijerinck) van Uden et Buckley, anamorph (ATCC® 2512)

Strain Designations: [BI CZAS 652/6, CCY 29-8-9]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Torula cremoris Hammer et Cordes
Strain Designations [BI CZAS 652/6, CCY 29-8-9]
Application
Assay of nicotinic acid niacin
Quality control strain
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Morphology After 3 days on YM agar at 25°C, the cells are globose, ellipsoidal to cylindrical, 2-6 x 3-11 µm, and occur singly, in pairs or in short chains. Growth is butyrous, glossy, cream colored to brown.
Sequenced Data
26S ribosomal RNA gene, partial sequence

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCACGGATGCTGGCGTAATGGTTAAATGCCGC

Morphology After 3 days on YM agar at 25°C, the cells are globose, ellipsoidal to cylindrical, 2-6 x 3-11 µm, and occur singly, in pairs or in short chains. Growth is butyrous, glossy, cream colored to brown.
Name of Depositor FW Tanner
Isolation Not known.
References

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

Winter WD Jr., et al. Nicotinic acid requirements of Candida pseudotropicalis. J. Bacteriol. 82: 616, 1961. PubMed: 13893828

Williams WL. Yeast microbiological method for determination of nicotinic acid. J. Biol. Chem. 166: 397-406, 1946.

YT MicroPlate. Biolog.

RapID Yeast PLUS QC Set. Remel.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation