Candida glabrata (Anderson) Meyer et Yarrow, anamorph (ATCC® 2001)

Strain Designations: CBS 138  /  Product Format: freeze-dried

Deposited As Torulopsis glabrata (Anderson) Lodder et de Vries, anamorph
Strain Designations CBS 138
Application
Control strain for identification
Mapping of mitochondrial DNA
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Genome Sequenced Strain

Yes

Comments
MIC of 2-hydroxychalcone, 75 mcg/ml
Genome sequencing strain (completed by Genolevures Consortium, France).
Sequenced mitochondrial genome.
Morphology Colonies after 3 days on YM medium at 25°C are white, smooth, butyrous and entire. Cells are subglobose to ovoidal, single and in pairs pseudohyphae are absent.
Medium Medium 200: YM agar or YM broth
Medium 1245: YEPD
Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TAATTGATTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCTATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACATTGTGTTTGGTAGTGAGTGATACTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATAAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAG


Large subunit ribosomal RNA gene, partial sequence.

CAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGTACCACTTTGGGACTGTACTTTGCCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGGCGAGGGTGTCAGTTCTTTGTAAAGGGTGCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTTGCCTCTCGTGGGCTTGGGACTCTCGCAGCTCACTGGGCCAGCATCGGTTTTGGCGGCCGGAAAAAACCTAGGGAATGTGGCTCTGCGCCTCGGTGTAGAGTGTTATAGCCCTGGGGAATACGGCCAGTCGGGACCGAGGACTGCGATACTTGTTATCTAGGATG

Morphology Colonies after 3 days on YM medium at 25°C are white, smooth, butyrous and entire. Cells are subglobose to ovoidal, single and in pairs pseudohyphae are absent.
Name of Depositor CBS
Isolation
Feces
Cross References

Nucleotide (GenBank) : JQ070075 ITS including 5.8S rRNA gene

References

. . J. Infect. Dis. 1: 98, 1917.

. . Mycopathol. Mycol. Appl. 1: 0..

Sato M, et al. Growth inhibitory properties of chalcones to Candida. Lett. Appl. Microbiol. 18: 53-55, 1994.

. . Curr. Genet. 1: 209-217, 1980.

Maiwald M, et al. Rapid presumptive identification of medically relevant yeasts to the species level by polymerase chain reaction and restriction enzyme analysis. J. Med. Vet. Mycol. 32: 115-122, 1994. PubMed: 8064542

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

Nakayama H, et al. Depletion of the squalene synthase (ERG9) gene does not impair growth of Candida glabrata in mice. Antimicrob. Agents Chemother. 44: 2411-2418, 2000. PubMed: 10952588

Abbreviated Identification of Bacteria and Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M35-A2.

Dujon B, et al. Genome evolution in yeasts. Nature 430: 35-44, 2004.

Koszul R, et al. The complete mitochondrial genome sequence of the pathogenic yeast Candida (Torulopsis) glabrata. FEBS Lett. 534: 39-48, 2003. PubMed: 12527359

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

RapID™ Yeast PLUS QC Set. Remel™.