Penicillium aurantiogriseum Dierckx, anamorph (ATCC® 16025)

Strain Designations: IMI 19759 [CBS 201.57, QM 8403]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Penicillium cyclopium Westling, anamorph
Strain Designations IMI 19759 [CBS 201.57, QM 8403]
Application
fungus resistance testing electronic equipment
media testing
reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence. GenBank accession number: KC146355

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTCACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


Large subunit ribosomal RNA gene, partial sequence. GenBank accession number: KC146370

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGA

Name of Depositor IMI
Chain of Custody
ATCC <-- IMI <-- AS Boughey
Isolation
Hyacinthus sp. bulb, England
Cross References

Nucleotide (GenBank) : KC146355 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146370 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AF003241 Penicillium hirsutum var. venetum beta-tubulin gene, partial

References

. . British military specifications : .

Microbiology of food and animal feeding stuffs--Guidelines on preparation and production of culture media-- Part 2: Practical guidelines on performance testing of culture media.. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 11133-2:2003.

Microbiology of food and animal feeding stuffs --- Guidelines on preparation and production of culture media --- Part 2: Practical guidelines on performance testing of culture media - Annex B: Recommended test microorganisms for commonly used culture media. London, UK:British Standards Institution;British Standard DD CEN ISO/TS 11133:2003.

ISO/CD 11133:2009, Annex E. Test microorganisms for commonly used culture media (giving information on the culture medium, culture conditions, test microorganisms, culture collection number of test organisms and the expected reactions)

Corry, JEL, Curtis, GDW and Baird, RM (Eds) Handbook of Culture Media for Food and Water Microbiology. Royal Society of Chemistry, In preparation. ICFMH-WPCM.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation