Candida albicans (Robin) Berkhout, anamorph (ATCC® 14053)

Strain Designations: NIH 3172  /  Product Format: freeze-dried

Strain Designations NIH 3172
Application
Control strain for identification
Quality control strain
Produces estrogen-binding protein
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
PCR profile
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATTAACTTGTCACACCAGATTATTACTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


26S ribosomal RNA gene, partial sequence.

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTG

Name of Depositor CW Emmons
Isolation
Human blood, Bethesda, MD
References

Skowronski R, Feldman D. Characterization of an estrogen-binding protein in the yeast Candida albicans. Endocrinology 124: 1965-1972, 1989. PubMed: 2647470

Thanos M, et al. Rapid identification of Candida species by DNA fingerprinting with PCR. J. Clin. Microbiol. 34: 615-621, 1996. PubMed: 8904425

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

Abbreviated Identification of Bacteria and Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M35-A2.

VITEK 2 YST Streamlined QC Set. bioMerieux.

VITEK 2 YST Comprehensive QC Set. bioMerieux.

RapID™ Yeast PLUS QC Set. Remel™.