Penicillium varians Smith, anamorph (ATCC® 10509)

Strain Designations: NRRL 2096 [CBS 386.48, G. Smith LSHB BB91, IFO 6112, IMI 40586, NCTC 4152, QM 7691]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL 2096 [CBS 386.48, G. Smith LSHB BB91, IFO 6112, IMI 40586, NCTC 4152, QM 7691]
Application
fungus resistance testing textiles
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology After 10 days on PDA at 25°C, colony is flat, velutinous to slightly floccose, dull grey. Reverse turning red, with dark green stippling. Penicilli biverticillate on short, pigmented stipes, with long slender phialides. Conidia ellipsoidal to near-cylindrical.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGCGAGCTCTCTGAGCTCAACCTCCCACCCGTGTCGTTTTTTAACACCTGTTGCTTTGGCAGGCCCACTGGGGGTCTCCCCGGTCGCCTGCGGACGCGCTGTCCTCGGGCCTGCGCCTGCCAGAGCACCCCCTGAACTCTGAAGAAGATAGGGCTGTCTGAGTACCTAGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCGCGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCCAAAGGCAGCGGCGACGCCTGTTGGGTCCTCGAGCGCATGGGGCTTTGTCACTCGCTCGGGAGGGACTCGCGGGCGTTGGTCACCACCACCATCTTTTTACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCTTTGAGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGTCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGCGGCCGCGCCCGTGTGAAGCGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTGTCCACCAGACTCGCCCGGGGAGGCTCAGCCGGCACTTGTGCCGGTGTACTCTTCCTCGGGCGGGCCAGCATCGGTTTGGGCGGCTGGTGAAAGGCCCTGGGAATGTAACACCCTCCGGGGTGCCTTATAGCCCAGGGTGTCATGCGGCCAGCCTGGACCGAGGCCCGCGCTTCGGCGAGGATGCTGGCGTAATGGTGGTCAACGGC

Morphology After 10 days on PDA at 25°C, colony is flat, velutinous to slightly floccose, dull grey. Reverse turning red, with dark green stippling. Penicilli biverticillate on short, pigmented stipes, with long slender phialides. Conidia ellipsoidal to near-cylindrical.
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- NCTC 4152
Isolation
Cotton yarn, England
References

AATCC Antifungal Activity, Assessment on Textile Materials: Mildew and Rot Resistance of Textile Materials. Research Triangle Park, NC:American Association of Textile Chemists and Colorists;AATCC Test Method 30-2004.

Pitt JI, Samson RA. Species names in current use in the Trichocomaceae (Fungi, Eurotiales). Regnum Veg. 128: 13-57, 1993.

Smith G. Some new species of Penicillium. Trans. Br. Mycol. Soc. 18: 88-91, 1933.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation