Aspergillus fumigatus Fresenius, anamorph (ATCC® 1022™)

Alternate State: Sartorya fumigata Vuillemin, teleomorph  /  Strain Designations: NRRL 163 [118, CBS 133.61, IMI 16152, LSHB Ac71, NCTC 982, QM 1981, WB 163]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations NRRL 163 [118, CBS 133.61, IMI 16152, LSHB Ac71, NCTC 982, QM 1981, WB 163]
Alternate State Sartorya fumigata Vuillemin, teleomorph
Application
quality control strain
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2
Product Format freeze-dried
Type Strain yes
Intended Use
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CCCTTTGTACACACCGCCCGTCGCTACTACCGATTGAATGGCTCGGTGAGGCCTTCGGACTGGCTCAGGGGAGTTGGCAACGACTCCCCAGAGCCGGAAAGTTGGTCAAACCCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGG
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- C Thom 118
Isolation
lung of chicken, Connecticut
Cross References

Nucleotide (GenBank) : HQ026746 ITS including 5.8S rRNA gene

References

Samson RA, Gams WTypification of the species of Aspergillus and associated teleomorphsIn: Samson RA, Gams WAdvances in Penicillium and Aspergillus systematicsNew YorkPlenum Presspp. 31-54, 1985

Applied Biosystems, MicroSeq Food Panel.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS
Other Documentation
Other Document
Microbial Characterization Data