Malassezia yamatoensis (ATCC® MYA-4956)

Strain Designations: CBS 9725 [JMC 12262, M 9985]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 9725 [JMC 12262, M 9985]
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Lipophilic or lipid-dependent yeast
Biomedical strain
Morphology After 6-7 days on Leeming & Notman modified (MLNA) agar at 32°C, colonies flat to convex, pale yellow-cream with undulating margin. Cells are ovoid to short cylindrical with monopolar budding.
Medium ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
ATCC® Medium 2693: modified Dixon (mDixon)
Growth Conditions Temperature: 30°C to 32°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAAAGCATGGGTCAGCCATACGGATGCGCAAGCGTCTCTGGCGACCTTTTTTTCCATTTATCCAAACCCGTGTGCACTGTGTAGCGTGTCTTTTTGGATGCGCTACGAAATTTCTACACTCGTATGTTGTATGTACGTGAATTTGTTGGACCGTAACTGGCCAACCAACTTTACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCGTGAATTCTCTCCCCCCTTTGGGTTGCGAAAGCAGTCCTAGGCGGCGGAGGTTGGATGGGCGATGCCTTGCGAGGCTGGCCCGAAAAGCATTAGCGCCTCGCTAGAGCCTCTAAGGGAGAGGCCCAAGTGACTTGGCCTTGGTCGGCTATGCCAAACCAAGACGGAGTGCAAGCGCAGCATGATACGTCATTTGCTGTGTGCGCCGCCGGCTTGGGGACGACCCAAGACAAGCGCTTGGAGCGAAGAGTGCGCTTCGAAGTAGCGTGGAGACGATTGTCTTGGAACGCATTCCCTTTTTCTTCTGGTCTCAAATCAGGTAGGATCACCCGCCGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCATTAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAACTTTGAAAGCTGGTACCTTTGGTGCCCGCGTTGTAACCTCGAGACGCGTTTTCCGTGCGGCGCTATGGACAAGTTCCTTGGAACAGGACATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGATGTACCGTGCTTTGTGATACGCGCTCCAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCGCTTGAAGTCAGCCATGCCGCTCAGGACTCAGCTTGGTTTTTGCCGAGTGTATTTCCTGGGTAGCAAGTCAGCATTGGTTTGGTGCGTCGGAGAAGCATCCTGGGAATGTAGCGCCCTCGGGCGTGTTATAGCCTAGGATTGGATACGACGTGCTAGACCAAGGAACGCAGCGCGCCTTTTGGCGGGTCTTCGGACACCTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAGTGGC

Morphology After 6-7 days on Leeming & Notman modified (MLNA) agar at 32°C, colonies flat to convex, pale yellow-cream with undulating margin. Cells are ovoid to short cylindrical with monopolar budding.
Name of Depositor CBS
Chain of Custody ATCC <-- CBS <-- Sugita T
Isolation Male patient with seborrheic dermatitis, Tokyo, Japan.
References

Sugita T, et al. A new yeast, Malassezia yamatoensis, isolated from a patient with seborrheic dermatitis, and its distribution in patients and healthy subjects. Microbiol. Immunol. 48: 579-583, 2004. PubMed: 15322337

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation