Cryptococcus terrestris (ATCC® MYA-4953)

Strain Designations: HD-42  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations HD-42
Application Produces pheomelanins
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Produces pheomelanins
Epidemiological study
Morphology On YM agar at 25°C after 4 days, colonies white to buff, mucoid, smooth, margin scalloped to eroded. Cells hyaline, ovoid to subglobose, smooth, 4-5 X 2-4 µm. Pseudohyphae not observed.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTATTGATTGGTCGAAAGACCTTATCAGATTCTACCACCTCTGTGAACCGTTGACCTCCGGGTTAATAATCAAACATCAGTGTAACGAACGTAAGAGTATCTTAACGAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTCAGTGTCATGAAATCTCAATCTAATATGTTTTCTGAACATGTTAGACTTGGACTTGGGCGTCTGCCAGTGATGGCTCGCCTCAAATGACTTAGTGGAACATCCCACATCAGTGTTAGACGTAATAAGTTTCGTCTCTCCTTGTGGTGATGACTGCTCAGAACCTGCCATCGCGCACTTTTGACTTTGACCTGAAATCAGGTAGGGCTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGTGCCGGACTGTGTCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCAGTCGGGTCAACATCAGTTTTGTTCGGTGGATAAGGGCAGCTGGAAGGTGGCACCTCCGGGTGTGTTATAGCCAGCTGTCGCATACACCGAATGAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM agar at 25°C after 4 days, colonies white to buff, mucoid, smooth, margin scalloped to eroded. Cells hyaline, ovoid to subglobose, smooth, 4-5 X 2-4 µm. Pseudohyphae not observed.
Name of Depositor H Dhillon
Chain of Custody ATCC <-- H Dhillon
Isolation Grevillea robusta, Solan, Himachal Pradesh, India.
References

Dhillon H, Sharma DR. Extracellular Deoxyribonuclease and Hemolysins Production by Cryptococcus species. Int. J. New Horiz. Pharm. Biomed. Sci. 1: 13-24, 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation