Cryptococcus diffluens (Zach) Lodder & Kreger-van Rij (ATCC® MYA-4947)

Strain Designations: HD-5  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cryptococcus diffluens
Strain Designations HD-5
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments May produce 2 types of colonies - wrinkled or smooth
Morphology After 4-5 days on YM agar at 25°C colonies smooth or wrinkled, cream, butyous, shiny or dull with entire or eroded margins. Cells are ellipsoid and reproduce by budding.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGATTAACTGTCTGTCGAGCTTGCTCACAGACTTATCATATCCATAACACCTGTGCACTTGTCGGATGGCTTAGTGAAGACCGCAAGGTTGGATCTATCCATCTACTTTACATAACAATTTAGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGAAAACCCTCAACCTTAGATTGGTTAACACCTTTCTTTGGCTTGGATTTGGACGTTTGCCGATGATAAGTCGGCTCGTCTTAAAAGTAATAGCTGGATCTGTCTCGCGACATGGTTTGACTTGGCGTAATAAGTATTTCGCTAAGGACATCTTCGGATGGCCGCGTTGCAAGACTAAAGACCGCTTTCTAATCCATTGATCTTCGGATTAATATTCTTGACATCTGGCCTCAAATCAGgTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTAGTAGCCTTCGGCTGCTCGAGTTGTAATCTAGAGAAGTGTTTTCCGTGCCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACCCCCGGTGCTCTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTCTTTGGTATTTATATCATTGAGTGGGGTCAACATCAGTTTTGAGCGATGGATAAAGGCACTAGGAAGGTAGCACTCTCGGGTGAACTTATAGCCTAGCGTCATATACATTGTTTGGGACTGAGGAACGCAGCATGCCTTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Morphology After 4-5 days on YM agar at 25°C colonies smooth or wrinkled, cream, butyous, shiny or dull with entire or eroded margins. Cells are ellipsoid and reproduce by budding.
Name of Depositor H Dhillon
Chain of Custody ATCC <-- H Dhillon
Isolation Callistemon lanceolatus, Solan, Himachal Pradesh, India.
References

Dhillon H, Sharma DR. Extracellular Deoxyribonuclease and Hemolysins Production by Cryptococcus species. Int. J. New Horiz. Pharm. Biomed. Sci. 1: 13-24, 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation