Phytophthora mississippiae Yang et al. (ATCC® MYA-4946)

Strain Designations: 57J3  /  Product Format: frozen

Strain Designations 57J3
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® no
Comments Potential plant pathogen
Morphology After 5 days on V-8 Rye agar at 20°C colonies cream colored, mainly appressed with some aerial mycelium around the plug. Catenulate, globose hyphal swellings observed. Mycelia flat, coiled, or often swollen. Hyphal swellings with irregular shapes. Sporangia not observed.
Medium Medium 1970: V8 rye agar
Medium 343: V8 juice agar
Medium 321: Lima bean agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCTAAAAAAACTTTCCACGTGAACCGTATCAACCCCTTAAATTTGGGGGCTTGCTCGGCGGCGTGCGTGCTGGCCTGTAATGGGTCGGCGTGCTGCTGCTGGGCGGGCTCTATCATGGGCGAGCGTTTGGGCTTCGGCTCGAGCTAGTAGCTATCAATTTTAAACCCTTTCTTAAATACTGAACATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCTGGCGGTCTTTCGAGTCTGCCGGTGAGTCCTTTGAAATGTACTGAACTGTACTCTCTCTTTGCTCGAAAAGCGTGGCGTTGCTGGTTGTGGAGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTTAGCTGTGGCGTTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAATCTGCTTATTGTGTGCTTTTCCTGTCATTGGCGGTACGAACTGGTGAACCGTAGCTGTGTGGTGCTTGGCTTTTGAACCGGCTTTGCTTTGCGAAGTAGTGTGGCGGCTTCGGCTGTCGAGGGGTCGATCCATTTTGGGAAACTTTGTGTGTGCGGCTTCGTGCTGCGCGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGCGCTGTGGCAGCGGCTTTTTTGGCTGCGCTCGGTGCGTGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 5 days on V-8 Rye agar at 20°C colonies cream colored, mainly appressed with some aerial mycelium around the plug. Catenulate, globose hyphal swellings observed. Mycelia flat, coiled, or often swollen. Hyphal swellings with irregular shapes. Sporangia not observed.
Name of Depositor C Hong
Chain of Custody ATCC <-- C Hong
Isolation Irrigation water, Mississippi, USA
References

Yang X, Copes WE, Hong C. Phytophthora mississippiae sp. nov., a new species recovered from irrigation reservoirs at a plant nursery in Mississippi. J. Plant Pathol. Microb. 4: 180, 2013. doi:10.4172/2157.7471 1000180.