Phytophthora macilentosa Yang et al. (ATCC® MYA-4945)

Strain Designations: 58A7  /  Product Format: frozen

Deposited As Phytophthora macilentosa
Strain Designations 58A7
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Potential plant pathogen
Morphology After 5 days on V-8 agar at 20°C, colony is white, cottony, radiating. Sporangia and oogonia not observed. After 5 days on V-8 Rye agar at 20°C, colony is hyaline, submerged. Sporangia and oogonia not observed.
Medium ATCC® Medium 321: Lima bean agar
ATCC® Medium 343: V8 juice agar
ATCC® Medium 1970: V8 rye agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTACCACACCTAAAAACTTTCCACGTGAACTGTGTTGTCGATGTTGGGGGCTGGGCTGGCRTTTGTTCGTCRGTTGGGCTCCATCAAACGAGGCTCTGGGCTGAAAAGTCGAGGGTAGTAGTTACTTTTTGTAAACCCTTTTTAAGTTTTTCTGAATATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATGAATCTTGTCTTCCTTCCTTCCGTGTAGTCGGTGGCGGGAATGCGCAGACGTGAAGTGTCTTGCTGGTTGGTTCCTTTCGGGGAGGTGTCCGGCGAGTCCTTTGAAATGTAAGACACTGTTCTTCTCTTTGCTGGAAAAGCGTGCGTTGTGTGGTTGTGGAGGCTGCCGTTGTGGCCAGTCGGCGACTGACTTCGTGCTGAGGCGTGTGGAGAGGAGCTCGATTCGCGGTATGGTTGGCTTCGGCTGAACTTCTGCTTATGGAGCTGTTTTCTGGTGTTTCGGCGTGGCGGGGTTAGTGAACCGTAGTCATGGTGGCTTGGCTTTTGAACTGCGCGGCTGTTGCGCRAAGTATGGTGGCTTCGGCCGAGAGGACGACCTATTTGGGACGATTGTGTGGCTTGTTTGCTGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATGGAGGCGTGGTCAGCGCGGGCGCTCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGTGCCGCTTGCGCGTACGACCCGTGTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATCTTTGAGTGTGTGCGTGTGCGCTTGTTCGCAGCGGCTTTTTTGGCTGCGCGGGTTGTGTGCTGTGCATGTGGTTGGAGGTGCCCTGTGCTGCAGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCTCTGTGTGCCCGGTGTGCGGATAGCTTGCTATGCGTGTGCTGTCGTGCGCGGATTGTGGTGCGCTGTAACTTGTTGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 5 days on V-8 agar at 20°C, colony is white, cottony, radiating. Sporangia and oogonia not observed. After 5 days on V-8 Rye agar at 20°C, colony is hyaline, submerged. Sporangia and oogonia not observed.
Name of Depositor X Yang, C Hong
Chain of Custody ATCC <-- X Yang
Isolation Irrigation water, Mississippi, USA
References

Yang X, Copes WE, Hong C. Two novel species representing a new clade and cluster of Phytophthora. Fungal Biol. 118: 72-82, 2014.