Phytophthora stricta Yang et al. (ATCC® MYA-4944)

Strain Designations: 58A1  /  Product Format: frozen

Deposited As Phytophthora stricta
Strain Designations 58A1
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Potential plant pathogen
Morphology After 5 days on V-8 agar at 20°C, colony is white, downy, showing rosette growth pattern. Sporangia and oogonia not observed. After 5 days on V-8 Rye agar at 20°C, colony is hyaline, submerged. Sporangia and oogonia not observed.
Medium Medium 321: Lima bean agar
Medium 343: V8 juice agar
Medium 1970: V8 rye agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTATCAACCACCTAGTTGGGGTTCTCGGTAGCYGTGTGGCATGTGGACTCGTTCTACGTGCTGCTGGCGGCTGAGACCTATCATGGCGAGCGTTTGGGCTTTCGGGCCTGGATTAGTAGCCCTCTTTTAAACTCATTCTGTAAAACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGATGGAGACGCCAGATGTGAAGTGTCTTGCGGCTGTCCGTTTTTCGGTCGACTGCGAGTCCTTTTAAATGTACTGAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCTGGTTGTGGAGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAACGCTTATTGGGTGCTTTTGCTGCTGTGGCGTGATGGACTGGTGAACCGTAGCTGTGTGAGCTTGGCTTTTGAACTAGTGGTGTAATGCGAAGTAGAGTGGCGTCGTGCGTCTTTATGGCGTGTGTTCGTCGAGGGTCGATCCATTTTGGGAAATGTTGTGTGTGCTTCGGCGCGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGATGCGTGGTCAGTGATGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCCGTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTWTTTTGGCTGCGCTCGGTGCGTGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCTGAGGAGGTAGGGCTTACGCTCCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTTTAACTTGTCGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 5 days on V-8 agar at 20°C, colony is white, downy, showing rosette growth pattern. Sporangia and oogonia not observed. After 5 days on V-8 Rye agar at 20°C, colony is hyaline, submerged. Sporangia and oogonia not observed.
Name of Depositor X Yang, C Hong
Chain of Custody ATCC <-- X Yang
Isolation Irrigation water, Mississippi, USA
References

Yang X, Copes WE, Hong C. Two novel species representing a new clade and cluster of Phytophthora. Fungal Biol. 118: 72-82, 2014.