Lagenidium albertoi (ATCC® MYA-4932)

Strain Designations: MTLA-13  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations MTLA-13
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Clinical isolate
Morphology After 8 days on Emmons’ modification of Sabouraud’s medium at 30°C, colony is white to cream-colored, flat, dense, furrowed. Hyphae hyaline, guttulate, sparsely septate. Sporulation not observed.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 307: Cornmeal agar
Medium 663: PYG medium
Growth Conditions
Temperature: 30°C to 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTACCACACCTAAAAAACTTTTCACGTGAACCGTTCTATTAGTTTTGTGCTTCTGCTGTAACTGCTAATCTGCCTTTGGTGGAATAGTGGATGCGGTGGAGGCTGAACGAAGGTTGATTTTGGCGAAAGCTAGAGTCAGCTGATGAACTTTTAAACCCTTACCTAATTACTGATTAATACTCTAGGAACGAAAGTTCTTAGTTTTAAAGACAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTAAATCAAAATTGCCTTTCTTTTTCTGTGTAGTCAGGATTGGAAATGGCAGAATGTGAAGTGTCTCGAACGCTAACCTCTATGGTTAATGGTTGAGTCCTTTTAAATCGACACTGTCTCGCTATATAGTTACTGTGATTTGTTTCGCATGAACGCTGTGATCTACTGATCGCTTGCACGTGTTAGCAATCCAGTGAGAACATATAGGGTGAACCTCAATTTGCGGTATGTTTGGCTTCGGCTTGACAATCTTGCTTATTGTGTGGATCCTGTTTTTGCTGTGATATACTGATGTGTGTGGGCTTGAACGGTATTTTGCTGTTTAGTAATGTGTTACTGCTGGTAGCGCCGTTTACGGTTTTAGTGAGAAGTCCAGTTGGGAAACCAATATGGTGAGAAATCACTGTATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAATTTAAG


D1D2 region of the 28S ribosomal RNA gene.

CATATAACTAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCATACGAGTTTCGTGTGGCGAATTGTAGTCTATAGAGGCGATGTCAGTGCGGCTGTTCGGGATAAGTCCCTTGGAAAAGGGCAGCATCGAGGGTGATACTCCCGTTCGTGCCTGAGCAGCTAGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCTAATCGTATCCAGTGTCTATAATCCGCAGCATATTTCATTGGCGAGTTGATGCGTGCAGTGTTTTGACAGTGGCTTGCCGCGTCGTGCATTGTTCTGCGTTAGCTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGTCAGTTGAGGAGGTAGGTAGGTGCTTGCGCTTACTGTTATATCTCGATTGACTAGTAGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTAAAGTCTTGCGGATGCTCGTTTGGCCTGTTGCTTGGATAGCTTGCTATGCTGGTGATAAGGTTAGGCGATTGTGTTTGTAAGTAACTTTTGCCGTTCGGGACTTTGACGAAATGGAGCGATTAGGC

Morphology After 8 days on Emmons’ modification of Sabouraud’s medium at 30°C, colony is white to cream-colored, flat, dense, furrowed. Hyphae hyaline, guttulate, sparsely septate. Sporulation not observed.
Name of Depositor L Mendoza
Chain of Custody ATCC <– L Mendoza <– A Chindamporn
Isolation human corneal tissue, Thailand
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation