Candida tunisiensis Eddouzi et al. (ATCC® MYA-4931)

Strain Designations: JEY63 [CBS 12513]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Candida tunisiensis
Strain Designations JEY63 [CBS 12513]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Clinical isolate
Morphology Colonies on YM agar after 4-5 days white, circular with mycelial border, rough with convex elevation. Yeast cells round to ovoid, single or in pairs and budding. Pseudohyhae present.
Medium Medium 200: YM agar or YM broth
Medium 28: Emmons' modification of Sabouraud's agar
Medium 343: V8 juice agar
Growth Conditions Temperature: 25°C to 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGGAGAAATCCAAAATCTTTCAACACTTGTGAACCATTGAATTTTGCTTTGGCCAGCTGGGTCATTCCAGCCTGGCCAAAGTTTATAATCAAACACGTTTTATTTTATGTTTTTCAAAAGAACTATTTAATTATAATTCTTTTAAAACTCTTAGCAACGGATCTCTAGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTTTGTGAATCATCGAATCTTTGAACGCAAATTGCGCTTTTTGGTATTCCAAAGAGCATATTTGTTTGAGCATCATTTCTCTCTCAATCCCAGGATTGGTTTTGATGTCTTTTTTGTGTTCGTTTACGGACGCGAAAATACATTGAAAGAGAATGGCATAAACGCCAGAGAGCAGCCAAGTGTAGGAGGTTTATCCCTATCACTTTGAGCTTTCTAATTTTTGTTTTGTGCCTTATAAACAAACCTTTTAAAAGTTTGATCTCAAATCAAATAAGAATACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

TCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTCCCTTAGTAGCGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTAGTACTTTCAGTGCTCGAATTGTAATTTGAAGATGGCAACTTTGGAATTGGAACTGGCATATGTTTCTTGGAACAGAACGTCATAGAGGGTGAGAACCCCGTTCATGGCTGGATTACCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTAGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGCTAAGAGGGAAGGGCTTGAGGTCAGACTTGGTTTCAGAGTTTAATAGTCTCTCGTGGATTATGTTTCTCTGTTTTCCAGGCCAGCATCGGTTTGGACGGTGAGAAAAGATACCCTGGAATGTGGCTTCTCTCGAGAAGTGTTATAGCCTAGGTTGATATCACCAGTCTAGACCGAGGACCGCGCATTTGCTAGGATGCTGGCGTAATGGCCTTAAGCCAC

Morphology Colonies on YM agar after 4-5 days white, circular with mycelial border, rough with convex elevation. Yeast cells round to ovoid, single or in pairs and budding. Pseudohyhae present.
Name of Depositor CBS
Chain of Custody ATCC <-- CBS <-- D Sanglard
Isolation Candidemia patient, Tunis, Tunisia.
Cross References

Nucleotide (GenBank) : KF278465 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KF278481 D1/D2 region of 26S rRNA gene

References

Eddouzi J et al., Characterization of a new clinical yeast species, Candida tunisiensis sp. nov., isolated from a strain collection from Tunisian hospitals. J. Clin. Microbiol. 51:31-39, 2013. PubMed: 23077122

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation