Phytophthora pluvialis Reeser et al. (ATCC® MYA-4930)

Strain Designations: LC-9.2-020508  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations LC-9.2-020508
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Plant pathogen
Morphology After 10 days on V8 Rye medium at 20°C, colony appressed, cream-colored. Oogonia terminal, smooth, globose, golden orange, with amphigynous antheridia.
Medium Medium 323: Malt agar medium
Medium 343: V8 juice agar
Medium 1970: V8 rye agar
Growth Conditions
Temperature: 15°C to 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACTGTATCGAACAACTAGTTGGGGGTCTTGTTTGGCGTGCGGCTGCTTCGGTAGCTGCTGCTAGGCGAGCCCTATCACGGCGAGCGTTTGGACTTCGGTCTGAACTAGTAGCTATTTTTTAAACCCATTCTTTAATACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCGGCGAATTTTCGAATTTGCTGTGAGTCCTTTGAAATGTACTGAACTGTACTTCTCTTTGCTCGAAAAGCGTGGCGTTGCTGGTTGTGGAGGCTGCCCGCGTGGCCAGTCGGCGACCGGTTTGTCTGCTGTGGCATTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATTGGATGTTCTTCTTGCTGTGGCGTGACGGACTGGTGAACCGTAGCTATGTGTGGCTTGGCTTTTGAATCGGCTTTGCTGTTGCAAAGTAGAGTGGCGGCTTCGGCTGTCGAGGGTCGATCCATTTGGGAAATTTGTGTGTATGACTTCGGTTGTATGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGCGGTCTTTATGGCTGCGCTCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 10 days on V8 Rye medium at 20°C, colony appressed, cream-colored. Oogonia terminal, smooth, globose, golden orange, with amphigynous antheridia.
Name of Depositor P Reeser
Chain of Custody ATCC <-- P Reeser
Isolation Rain collected under forest canopy, Curry County, Oregon, USA
References

Reeser P, Sutton W, Hansen E. Phytophthora pluvialis, a new species from mixed tanoak-Douglas-fir forests of western Oregon, U.S.A. North American Fungi 8(7): 1-8. 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation