Rhizoctonia sp. (ATCC® MYA-4929)

Strain Designations: A3  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations A3
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® no
Comments Endophytic fungus demonstrated in vitro synthesis of silver nanoparticle when subjected to silver nitrate and silver sulfate.
Morphology On PDA medium at 25°C after 6 days, mycelium white, yellow, and reddish brown in concentric rings, velvety to cottony, dense. Reverse bright yellow. Hyphae some hyaline and some dematiacous, guttulate.
Medium ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AGTTGGTTGTCGCTGGCCCCTTCACCGGGGCATGTGCACGCCTCCTCTATTCATCCACACACACCTGTGAACTTGTGAGACGGATAGTAGCCCTTTCGGGGGCGAGGTCCGTCTGCTATACATAAACTCCAATATATAAATTTGAATGTAATTTGATGTAACACATCTTTAAACTAAGTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCTCGGAGCATGCCTGTTTGAGTATCATGAAATCCTCAAAATAAATCTTTTGTTCATTCGATTGATTTTATTTTGGACTTGGAGGTCTGCAGATTCACGTCTGCTCCTCTTAAATGTATTAGCTGGATCTCAGTGAACTCGGTTCCACTCGGCGTGATAAGTATCACTCGCTGAGGACACTGTAAAAGGTGGCCGGGGTTGCAGACGAACCGCTTCTAATCGTCCATTCACTTGGACAATTTATTTATGATCTGATCTCAAATCA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTTTACCGTCCGAGTTGTAGTCTAGAGAAGCATCATCTACGCTGGACCATGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACTCCCAGTGTTCTGTGTTGTGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAGAGAGAGTTAAACAGTACGTGAAATTGTTGAAATGGAAACGCTTGAAGTCAGTCGCGTTCTCTGGGATTCAGCCTTGCTTTTGCTTGGTGCATTTCCTAGTCTACGGGCCAGCATGGATTTTGACCGTTGGAAAAGGGCTGGGGGAATGTGGCACTTTCGGGTGTGTTATAGCCCCCTGTCGCATGCATCGGTTGGGATCGAGGACCTCAGTGCACGCTTCGGTTGTGCTTTGATGCTGGCGTAATGGCTTTAAACGA

Morphology On PDA medium at 25°C after 6 days, mycelium white, yellow, and reddish brown in concentric rings, velvety to cottony, dense. Reverse bright yellow. Hyphae some hyaline and some dematiacous, guttulate.
Name of Depositor D Raudabaugh
Chain of Custody ATCC <-- D Raudabaugh <-- AN Miller
Isolation Conocephalum conicum, Clinton County, Pennsylvania, USA.
References

Raudabaugh DB, et al. Synthesis of silver nanoparticles by a bryophilous Rhizocotonia species. Nanomater. Nanotechnol. 3: Art. 2, 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation