Aspergillus parasiticus Speare, anamorph (ATCC® MYA-4920)

Strain Designations: FGSC A1243  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Aspergillus parasiticus
Strain Designations FGSC A1243
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype deltaku70
Preceptrol® no
Morphology On PDA medium at 25°C after 7 days, mycelium white becoming dark green as conidia develop, velutinous to powdery, dense. Reverse tan. Hyphae hyaline, guttulate. Conidial heads globose, uniseriate, 22.5-25 X 22.5-25 µm. Conidia green in mass, globose, verruculose, 4-6 X 3.5-6 µm.
Medium Medium 200: YM agar or YM broth
Medium 324: Malt extract agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGCGTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAAACAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGA

Morphology On PDA medium at 25°C after 7 days, mycelium white becoming dark green as conidia develop, velutinous to powdery, dense. Reverse tan. Hyphae hyaline, guttulate. Conidial heads globose, uniseriate, 22.5-25 X 22.5-25 µm. Conidia green in mass, globose, verruculose, 4-6 X 3.5-6 µm.
Name of Depositor Fungal Genetics Stock Center (FGSC)
Chain of Custody ATCC <-- FGSC
Isolation Mutant from Aspergillus parasiticus isolate BN009E (BN9).
References

Ehrilich KC, et al. Are the genes nadA and norB involved in formation of aflatoxin G(1)? Int. J. Mol. Sci. 9:1717-1729, 2008. PubMed: 19325828

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation