Trichoderma spirale (ATCC® MYA-4918)

Strain Designations: TUB F-901  /  Product Format: frozen

Classification Ascomycota, Pezizomycotina, Sordariomycetes, Hypocreomycetidae, Hypocreales, Hypocreaceae
Strain Designations TUB F-901
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype Not available
Preceptrol® no
Morphology On PDA medium at 25°C after 8 days, mycelium white with dark green tint, dense, cottony. Reverse tan to brown. Hyphae hyaline, guttulate. Conidiophores hyaline, branched. Phialides obclavate, single or in groups of 3-4, 12 x 3 µm. Conida green, broadly ellipsoidal, smooth, 3.75-4.5 x 3 µm.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC581162:

AGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTGTATACCCCCTCGCGGGTTTTTATATCTGAGCCATCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCATTGCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene; GenBank number KC581160:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTCGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCGCGTCTAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGTTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGA

Morphology On PDA medium at 25°C after 8 days, mycelium white with dark green tint, dense, cottony. Reverse tan to brown. Hyphae hyaline, guttulate. Conidiophores hyaline, branched. Phialides obclavate, single or in groups of 3-4, 12 x 3 µm. Conida green, broadly ellipsoidal, smooth, 3.75-4.5 x 3 µm.
Name of Depositor G. Szakacs
Chain of Custody ATCC <-- G. Szakacs; Budaoest University of Technology and Economics
Isolation

Park soil; Singapore.

Cross References

Nucleotide (GenBank) : KC581162 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KC581160 D1D2 region of the 28S ribosomal RNA gene

References

Kubicek CP, et al. Genetic and metabolic diversity of Trichoderma: a case study on South-East Asian Isolates. Fungal Genet. Biol. 38(3): 310-319, 2003. PubMed: 12684020