Trichoderma spirale (ATCC® MYA-4917)

Strain Designations: TUB F-825  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Ascomycota, Pezizomycotina, Sordariomycetes, Hypocreomycetidae, Hypocreales, Hypocreaceae
Strain Designations TUB F-825
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology On PDA medium at 25°C after 8 days, mycelium white with green tint, cottony, dense. Reverse yellowish tan. Hyphae hyaline, guttulate. Conidiophores hyaline, branched. Phialides obclavate, single or in groups of 2-3, 12 x 3-3.75 µm. Conida green, broadly ellipsoidal, smooth, 3.75-4.5 x 2.25-3 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC581161:

AGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTGTATACCCCCTCGCGGGTTTTTTATATCTGAGCCATCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCATTGCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene; GenBank number KC581159:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTCGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCGCGTCTAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGTTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGA

Morphology On PDA medium at 25°C after 8 days, mycelium white with green tint, cottony, dense. Reverse yellowish tan. Hyphae hyaline, guttulate. Conidiophores hyaline, branched. Phialides obclavate, single or in groups of 2-3, 12 x 3-3.75 µm. Conida green, broadly ellipsoidal, smooth, 3.75-4.5 x 2.25-3 µm.
Name of Depositor G. Szakacs
Chain of Custody ATCC <-- G. Szakacs; Budapest University of Technology and Economics
Isolation Soil, Botanical Garden; Rio de Janeriro, Brazil.
Cross References

Nucleotide (GenBank) : KC581161 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KC581159 D1D2 region of the 28S ribosomal RNA gene

References

Druzhinina IS, et al. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet. Biol. 42: 813-828, 2005.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation