Dictyostelium maeandriforme Cavender et al. (ATCC® MYA-4864)

Strain Designations: OH604  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Dictyosteliales
Strain Designations OH604
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Genotype Not available
Preceptrol® no
Comments Grown in two-member culture with Escherichia coli (ATCC 23437)
Morphology On LY agar after 10 days at 20°C, Sorocarps erect, meandering, solitary, unbranched and variable in height.
Sequenced Data
18S ribosomal RNA gene, partial sequence:

GAAACTGCAGACGGCTCATTACAACAGTAATAAACTAATAGACTTTCGGGTTTAATTACCTTTTGGATAACCGCAGTAAATCGGGGCTAATACATACAATCGAGGGGTGACTGTTTACGGAATCTCCGCGATTATTAGCATTCAACCAATACCTTTCGAGGTTTTGTGGTGAAACCGAATAATATTGCAGATCGAAGCTTCGGCTTTGACAAGTCTATTGTGTTACTGCCCTATCAACTTTCGATGGTACGGTATTGGCCTACCATGGTTGTAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGCGCCTGAGAAATGGCGACCACTTCTACGGAAGGCAGCAGGCGCGCAAATTACTCAATCCCAATACGGGGAAGTAGTGACAAGAAATATTAATGCCTATCCTTTTAGGAAGGTAATTAAAATGGGTCTAAACTAAATCCATTTTCTAATACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATATACTAAATTTGTTGCGGTTAAAAAGCTCGTAGTTTAAACAAAAATTATATTGGGCTAATAGGTGTTAGCCGGATTTTTATAAGCCGGTTTAATACTTCCAATATATATTTTTTAAATATTAGCTCTTGGATTTGGTTACTTTTGTAATTCAAGTTCGTTAGAGTCCTTCACTGTGAGAAAATTGTGGTGCTTAAAGCAGGCGTTTCGCTTGATCTTTTGCAGCATGGTATGATAGAACATGACATTTTGTGCTATTGGTTGCATTAAAGTGTAATGATTAATAGGGATGGATGGGGGTGTTCATATTGGTGGGCGAGAGGTGAAATTCGTTGACCCTATCAAGATGAACTTCTGCGAAAGCATTCACCAAATACTTCCCCATTAATCAAGAACGAAAGTTTGGGGATCAAAGACGATCAGATACCGTCGTAGTCCAAACTATAAACTATGTCGACCAGGGATCAGCTAAAATTTCTAAAAAATTTAGTTGGCACCTTGTGAGAAATCACGAGTGTTTAGATTCTGGGGGGAGTATGGTCGCAAGTCTGAAACTTAAAGGAATTGACGGAAGGGCACACAATGGAGTGGAGCCTGCGGCTTAATTTGACTCAACTCGGGAAAACTTACCAAGCTAAGATATAATAAGGATTGACAGACTAAAAGATCTTTCATGATTGTATAAGTGGTGGTGCATGGTCGTTCTTAGTTGGTGGAGCAATCTGTCTGGTCAATTCCGATAACGGACGAGATCTCGACCTGCTAACTAGTAGTACATATTAGCTCAATATGCATGAAAGATTAGTTGGAGTAAGTTGTAGGTCGAAAGGTTTACAGCACTTCACTGGTTCGGTAATGTGAATTAATATGGTACGATAAATAAAACTTCTTAGAGGGACTACCTGTGGCAAACAGGGGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCTTAGATACCTTGGGCCGCACGCGCGCTACAATGTAGTACGCAAAAAGCTCTCCTGGTCCGGAAGGATTGGGTAATCAAAAAATTTACTACGTAACTGGGATTGATCTTTGTAATTATTGATCATCAACGAGGAATTCCTTGTAAGCGCAAATCATTACTTTGTGCTGAATATGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATCGAATGATACGGTAAAGCCAACAGATTGGATCTGTAGCAATACAAGGTCTGAAAAGTTGTTTAAATCTCATTGTTTAGAGGAAGGAGAAGTCG

Morphology On LY agar after 10 days at 20°C, Sorocarps erect, meandering, solitary, unbranched and variable in height.
Name of Depositor J.C. Landolt
Chain of Custody ATCC <-- J.C. Landolt; Shepherd University <-- J.C. Cavender
Isolation Soils of the semi-evergreen forest of Tikal, Guatemala; 1990
References

Cavender JC, et al. Ten new small dictyostelids from seasonal rain forests of Central America. Mycologica 105(3): 610-635, 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation