Dictyostelium capillare Cavender et al. (ATCC® MYA-4862)

Strain Designations: 37A  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Dictyosteliales, Dictyostelium
Strain Designations 37A
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Genotype Not available
Preceptrol® no
Comments Grown in two-member culture with Escherichia coli (ATCC® 23437™)
Morphology On LY agar after 10 days at 20°C, Sorocarps erect clusteres and variable in height.
Medium Medium 579: LY Agar for Filobasidium
Medium 2432: wMY (weak Malt Yeast Extract)
Medium 2219: Corn meal agar, half-strength
Growth Conditions Temperature: 20°C  to 25°C
Atmospheric: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence:

GAAACTGCAGACGGCTCATTACAACAGTAATAAACTAATAGACTTTCGGGTTTAATTACCTTTTGGATAACCGCAGTAAATCGGGGCTAATACATACAATCGAGGGGTGACTGTTTACGGAATCTCCGCGATTATTAGCATTCAACCAATACCTTTCGAGGTTTTGTGGTGAAACCGAATAATATTGCAGATCAAAGCTTTCGGCTTTGACAAGTCTATTGTGTTACTGCCCTATCAACTTTCGATGGTACGGTATTGGCCTACCATGGTTGTAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGCGCCTGAGAAATGGCGACCACTTCTACGGAAGGCAGCAGGCGCGCAAATTACTCAATCCCAATACGGGGAAGTAGTGACAAGAAATATTAATGCCTATCCTTTTAGGAAGGTAATTAAAATGGGTCTAAACTAAATCCATTTTCTAATACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATATACTAAATTTGTTGCGGTTAAAAAGCTCGTAGTTTAAACAAAAATTATATTGGGCTAATAGGTGTTAGCCGGATTTTTATCCCGGTTTAATACTTCCAATATATATTTTTTAAATATTAGCTCTTGGATTTGGTTACTTTTGTAATTCAAGTTCGTTAGAGTCCTTCACTGTGAGAAAATTGTGGTGCTTAAAGCAGGCGTTTCGCTTGATCTTTTGCAGCATGGTATGATAGAACATGACATTTTGTGCTATTGGTTGCATTAAAGTGTAATGATTAATAGGGATGGATGGGGGTGTTCATATTGGTGGGCGAGAGGTGAAATTCGTTGACCCTATCAAGATGAACTTCTGCGAAAGCATTCACCAAATACTTCCCCATTAATCAAGAACGAAAGTTTGGGGATCAAAGACGATCAGATACCGTCGTAGTCCAAACTATAAACTATGTCGACCAGGGATCAGCTAAAATTTCTAAAAAATTTAGTTGGCACCTTGTGAGAAATCACGAGTGTTTAGATTCTGGGGGGAGTATGGTCGCAAGTCTGAAACTTAAAGGAATTGACGGAAGGGCACACAATGGAGTGGAGCCTGCGGCTTAATTTGACTCAACTCGGGAAAACTTACCAAGCTAAGATATAATAAGGATTGACAGACTAAAAGATCTTTCATGATTGTATAAGTGGTGGTGCATGGTCGTTCTTAGTTGGTGGAGCAATCTGTCTGGTCAATTCCGATAACGGACGAGATCTCGACCTGCTAACTAGTAGTACATATTAGCTCAATATGCATGAAAGATTAGTTGGAGTAAGTTGTAGGTCGAAAGGTTTACAGCACTTCACTGGTTCGGTAATGTGAATTAATATGGTACGATAAATAAAACTTCTTAGAGGGACTACCTGTGGCAAACAGGGGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCTTAGATACCTTGGGCCGCACGCGCGCTACAATGTAGTACGCAAAAAGCTCTCCTGGTCCGGAAGGATTGGGTAATCAAAAAATTTACTACGTAACTGGGATTGATCTTTGTAATTATTGATCATCAACGAGGAATTCCTTGTAAGCGCAAATCATTACTTTGTGCTGAATATGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATCGAATGATACGGTAAAGCCAACAGATTGGATCTGTAGCAATACAGAGCTGAAAAGTTGTTTAAATCT

Morphology On LY agar after 10 days at 20°C, Sorocarps erect clusteres and variable in height.
Name of Depositor JC Landolt
Chain of Custody ATCC <-- J.C. Landolt; Shepherd University
Isolation Soils collected from seasonal rain forest Bladen Preserve, Belize
References

Cavender JC, et al. New small dictyostelids from seasonal rainforests of Central America. Mycologia 105: 610-635, 2013. PubMed: 23396155

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation