Pisolithus microcarpus (ATCC® MYA-4687)

Strain Designations: 441  /  Product Format: frozen

Classification Sclerodermataceae
Strain Designations 441
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Genotype Not available
Preceptrol® no
Comments Genome sequencing strain (Sequenced by DOE)
Morphology On MMNC medium at 25°C after 46 days, mycelium creamy white becoming yellow to tan, dense. Produces a dark reddish brown exudate on top of the culture and releases a chemical that turns the media dark brown. Hyphae hyaline singly and yellowish red in mass, guttulate, clamps present.
Medium Medium 336: Potato dextrose agar (PDA)
Medium 2798: MMNC Medium
Growth Conditions Temperature: 20°C to 25°C
Atmospheric: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC460710:

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGAAACTCGAAAGGTGCGGAGGGGGGACCTTTGCCGGTCCTTCGAAGCCCTTTTTACTTTGTCCACACCTCTGTGCACCCCCGTTCGCGCGAGGTTCTTCGGAACCCTGTGCGATGCTTATCTCGAACTCGTATGTCTACAGAATGTAACCTAGTGTGTTGGAAATGGAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAATCGCGATAAGTAATGTGAATTGCAGATTTTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAAAATCTCAAGCCGAGCTGTTTTGACTTTGGTTGAAAAAGCCCGGATTTTGGAGTGTTGGGAGGTCTGCAGGCAGTCCTGATCTTTTGGGACTGCCAGCTCTCCTGAAATGCATTAGTGGGATGGGCGTGTGACCAGCCTCTTCGACGTCGTAATGCGATCGTCGTGGACTGTGAGCTTTTTCCCCCCCTTGACTTTGCTATTGTGTGAAGGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Morphology On MMNC medium at 25°C after 46 days, mycelium creamy white becoming yellow to tan, dense. Produces a dark reddish brown exudate on top of the culture and releases a chemical that turns the media dark brown. Hyphae hyaline singly and yellowish red in mass, guttulate, clamps present.
Name of Depositor F. Martin
Chain of Custody ATCC <-- F. Martin; Institut National de la Recherche Agronomique (INRA) <-- M. Ivory
Isolation Under Eucalyptus citriodora, Sao Paulo, Brazil.
Cross References

Nucleotide (GenBank) : KC460710 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

References

Martin F, et al. Phylogeography of the ectomycorrhizal Pisolithus species as inferred from nuclear ribosomal DNA ITS sequences. New Phytologist 153: 345-358, 2002.

Diaz CE, et al. Ribosomal DNA internal transcribed spacesr to estimate the proportion of Pisolithus tinctorius and Eucalyptus globulus RNAs in Ectomycorrhiza. Appl. Environ. Microbiol. 63: 840-843, 1997. PubMed: 9055405