Pisolithus microcarpus (ATCC® MYA-4687)

Strain Designations: 441  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Sclerodermataceae
Strain Designations 441
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype Not available
Preceptrol® no
Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On MMNC medium at 25°C after 46 days, mycelium creamy white becoming yellow to tan, dense. Produces a dark reddish brown exudate on top of the culture and releases a chemical that turns the media dark brown. Hyphae hyaline singly and yellowish red in mass, guttulate, clamps present.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 2798: MMNC Medium
Growth Conditions Temperature: 20°C to 25°C
Atmospheric: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC460710:

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGAAACTCGAAAGGTGCGGAGGGGGGACCTTTGCCGGTCCTTCGAAGCCCTTTTTACTTTGTCCACACCTCTGTGCACCCCCGTTCGCGCGAGGTTCTTCGGAACCCTGTGCGATGCTTATCTCGAACTCGTATGTCTACAGAATGTAACCTAGTGTGTTGGAAATGGAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAATCGCGATAAGTAATGTGAATTGCAGATTTTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAAAATCTCAAGCCGAGCTGTTTTGACTTTGGTTGAAAAAGCCCGGATTTTGGAGTGTTGGGAGGTCTGCAGGCAGTCCTGATCTTTTGGGACTGCCAGCTCTCCTGAAATGCATTAGTGGGATGGGCGTGTGACCAGCCTCTTCGACGTCGTAATGCGATCGTCGTGGACTGTGAGCTTTTTCCCCCCCTTGACTTTGCTATTGTGTGAAGGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Morphology On MMNC medium at 25°C after 46 days, mycelium creamy white becoming yellow to tan, dense. Produces a dark reddish brown exudate on top of the culture and releases a chemical that turns the media dark brown. Hyphae hyaline singly and yellowish red in mass, guttulate, clamps present.
Name of Depositor F. Martin
Chain of Custody ATCC <-- F. Martin; Institut National de la Recherche Agronomique (INRA) <-- M. Ivory
Isolation Under Eucalyptus citriodora, Sao Paulo, Brazil.
Cross References

Nucleotide (GenBank) : KC460710 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

References

Martin F, et al. Phylogeography of the ectomycorrhizal Pisolithus species as inferred from nuclear ribosomal DNA ITS sequences. New Phytologist 153: 345-358, 2002.

Diaz CE, et al. Ribosomal DNA internal transcribed spacesr to estimate the proportion of Pisolithus tinctorius and Eucalyptus globulus RNAs in Ectomycorrhiza. Appl. Environ. Microbiol. 63: 840-843, 1997. PubMed: 9055405

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation