Candida parapsilosis (Ashford) Langeron et Talice, anamorph (ATCC® MYA-4646™)

Strain Designations: CDC 317  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations CDC 317
Biosafety Level 1
Product Format frozen
Type Strain no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Wellcome Trust Sanger Insititute, UK).
RefButler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905
Morphology Colonies on YM agar at 25°C after 3 days cream-colored, flat to umbonate, semi-dull to glistening smooth. Yeast-like cells globose to oval single or budding.
Sequenced Data
ITS DNA sequence of MYA-4646  

GAACCTGCGGAAGGATCATTACAGAATGAAAAGTGCTTAACTGCATTTTTTCTTACACATGTGTTTTTCTTTTTTTGAAAACTTTGCTTTGGTAGGCCTTCTATATGGGGCCTGCCAGAGATTAAACTCAACCAAATTTTATTTAATGTCAACCGATTATTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCTTGAAAGAAAGGCGGAGTATAAACTAATGGATAGGTTTTTTCCACTCATTGGTACAAACTCCAAAACTTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA

 

D1D2 DNA sequence of MYA-4646

GGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGATAAGTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTG
Morphology Colonies on YM agar at 25°C after 3 days cream-colored, flat to umbonate, semi-dull to glistening smooth. Yeast-like cells globose to oval single or budding.
Name of Depositor M Ghannoum
Special Collection ATCC
Chain of Custody
ATCC <-- M Ghannoum
Isolation
health-care worker's hand
Cross References

Complete Genome (GenBank) : CABE00000000 Candida parapsilosis CDC317, whole genome shotgun sequencing project

References

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Kuhn DM, et al. Candida parapsilosis characterization in an outbreak setting. Emerg. Infect. Dis. 10: 1074-1081, 2004.

Rossignol T, et al. Transcriptional response of Candida parapsilosis following exposure to farnesol. Antimicrob. Agents Chemother. 51: 2304-2312, 2007.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS