Penicillium crustosum Thom, anamorph (ATCC® 90174)

Strain Designations: NHL 6491 [I-31]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NHL 6491 [I-31]
Application
produces roquefortine C
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology Colonies on malt agar are spreading, 6.0 to 6.5 cm. in 12 days, plane, heavy sporing with development of prominent conidial crusts, often zonate, approximately sage green with green color tending to persist in age; odor is pronounced, moldy.

Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCCCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

 

Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTATTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGAC

Morphology Colonies on malt agar are spreading, 6.0 to 6.5 cm. in 12 days, plane, heavy sporing with development of prominent conidial crusts, often zonate, approximately sage green with green color tending to persist in age; odor is pronounced, moldy.

Name of Depositor SI Udagawa
Chain of Custody
ATCC <-- SI Udagawa <-- E Sato
Isolation
bread for school lunch, Shinagawa-ku, Tokyo, Japan
References

. . Proc. Jpn. Assoc. Mycotoxicol. 34: 29-32, 1991.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation