Myriosclerotinia scirpicola (Rehm in Rabenhorst) Buchwald (ATCC® 60535)

Strain Designations: LMK 80-2  /  Product Format: frozen

Strain Designations LMK 80-2
Application
characterization
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
characterization
Morphology Colony and cell morphology: On PDA medium at 25°C after 6 days, mycelium white to buff, dense, velvety in the center, feathery and appressed at margin. Hyphae hyaline, guttulate.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACAGAGTTCATGCCCGAAAGGGTAGACCTCCCACCCTTGTGTATTATTACTTTGTTGCTTTGGCGAGCTGCCTTTGGGCCTTGTATGCTCGCCAGAGACTAATCAAACTCTTTTAATTAATGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTATTGAGTCCATGTCAGTAATGGCTGTCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAATTTTTTTTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

Morphology Colony and cell morphology: On PDA medium at 25°C after 6 days, mycelium white to buff, dense, velvety in the center, feathery and appressed at margin. Hyphae hyaline, guttulate.
Name of Depositor LM Kohn
Isolation
Scirpus lacustris, Norway
References

Schumacher T, Kohn LM. A monographic revision of the genus Myriosclerotinia. Can. J. Bot. 63: 1610-1640, 1985.