Myriosclerotinia scirpicola (Rehm in Rabenhorst) Buchwald (ATCC® 60535)

Strain Designations: LMK 80-2  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations LMK 80-2
Application
characterization
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
characterization
Morphology Colony and cell morphology: On PDA medium at 25°C after 6 days, mycelium white to buff, dense, velvety in the center, feathery and appressed at margin. Hyphae hyaline, guttulate.
Medium Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACAGAGTTCATGCCCGAAAGGGTAGACCTCCCACCCTTGTGTATTATTACTTTGTTGCTTTGGCGAGCTGCCTTTGGGCCTTGTATGCTCGCCAGAGACTAATCAAACTCTTTTAATTAATGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTATTGAGTCCATGTCAGTAATGGCTGTCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAATTTTTTTTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

Morphology Colony and cell morphology: On PDA medium at 25°C after 6 days, mycelium white to buff, dense, velvety in the center, feathery and appressed at margin. Hyphae hyaline, guttulate.
Name of Depositor LM Kohn
Isolation
Scirpus lacustris, Norway
References

Schumacher T, Kohn LM. A monographic revision of the genus Myriosclerotinia. Can. J. Bot. 63: 1610-1640, 1985.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation