Filobasidiella bacillispora Kwon-Chung (ATCC® 32609™)

Alternate State: Cryptococcus gattii (Vanbreuseghem et Takashio) Kwon-Chung et Boekhout  /  Strain Designations: NIH 444 [CBS 6956]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Filobasidiella neoformans Kwon-Chung, teleomorph
Strain Designations NIH 444 [CBS 6956]
Synonym Cryptococcus hominis var. tumefaciens (Curtis) Benham, Cryptococcus hondurianus Castellani, Cryptococcus bacillisporus Kwon-Chung et Bennett, Cryptococcus neoformans var. gattii Vanbreuseghem et Takashio
Alternate State Cryptococcus gattii (Vanbreuseghem et Takashio) Kwon-Chung et Boekhout
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Type Strain yes (type strain of Filobasidiella bacillispora, mating type alpha)
Antigenic Properties serotype B RefSchmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.
Mating Type mating type alpha RefKwon-Chung KJ. A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946, 1976.
Morphology After 3 days on YM medium at 30°C, colony is cream-colored, smooth, mucoid. Cells are globose or ovoidal, thick-walled.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATACTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCAGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA

D1D2 region of the 28S ribosomal RNA gene

GTCGTTTAAAGCCATTTTGTCAACATCCTAAGCTCGAACGTGGGCGAACCCCGGCCATAAAGGCGAGCTGCATTCCTCAGTCCCAACCAGTGTATGCGACAGGAGGCTATAACACACCCCGAAGAGTGCCACATTCCTCCAGCCCTTATCCACCGATCAGAACTGATGTTGACCCGTCTAAAGGGAATACACCAGCAGAACTGGCTGAACCCAATAGACACGACTGACTTCAATCGTTTCCCTTTCAACAATTTCACGTACTGTTTAACTCTCTTTCCAAAGTGCTTTTCATCTTTCCCTCACGGTACTTGTTCGCTATCGGTCTTCCACCAATATTTAGCTTTAGATGGAGTTTACCACCCATTTTGCGCTACACTCCCAAGTAACGCGACTCGTAGAAAACGTATCACAGAGCACTGGTGATCGTGTCAAGTACGGGATTGTCACCCTCTTTGATACCCTATTCCAAGGGACTTAGACACGGTCCAGCACGGAAAACGTTTCTGTAGATTACAACTCGGACGCCCGGAGGACGCCAGATTTCAAATTTGAGCTCTTCCCGGTTCACTCGCCGTTACTAAGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGATATG

Morphology After 3 days on YM medium at 30°C, colony is cream-colored, smooth, mucoid. Cells are globose or ovoidal, thick-walled.
Name of Depositor KJ Kwon-Chung
Isolation
sputum, Washington, USA
References

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946, 1976.

type strain of Filobasidiella bacillispora, mating type alpha

Kwon-Chung KJ, et al. (1557) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. basillisporus (Basidiomycota, Hymenomycetes, Tremello-mycetidae) Taxon 51: 804-806, 2002.

type strain of Filobasidiella bacillispora, mating type alpha

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946, 1976.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS