Mucor racemosus Fresenius, teleomorph (ATCC® 204008)

Product Format: frozen

Permits and Restrictions

View Permits

Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
termite mound soil eaten by chimpanzees
Morphology After 5 days on Potato dextrose medium at 25°C, colony is low, powdery, dark grey; reverse uncolored. Sporangia are grey, ovoid, columellate, stipes pigmented. Sporangiospores are grey, smooth-walled, irregularly shaped.
Medium Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGATCATTAAATAATCAATAATTTTGGCTTGTCCATCATTATCTATTTACTGTGAACTGTATTATTACTTGACGCTTGAGGGATGTTCCAGTGCTATAAGGATAGGCATTGGAAATGTTAACCGAGTCATAATCAAGCTTAGGCTTGGTATCCTATTATTATTTACCAAAAGAATTCAGAATTAATATTGTAACATAGACGTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACATTTGTTGAATAGGATGACTGAGAGTCTCTTGATCTTTTGATCTCGAACCTCTTGAAATGTACAAAGGCCTGATCTTGTTTAAAAGCCTGAACTTTTTTTTAATATAAAGAGAAGCTCTTGCGGTAAACTGTGCTGGGGCCTCCCAAATAACACATCTTTAAATTTGATCTGAAATCAGGTGGGATTACCCGCTGAACTTAAG

 

 

RNA polymerase II largest subunit (RPB1) gene, partial cds.

ATTGGCTAAACCCTGTCTATCATATTGGTAAGTGTGATGATATACTATATAGATGATGACATGAAGCTCATGTGTCTTGCTGTAGGTTTCTTGACAAAAGTAAAAAAGATCCTTGAATGTGTTTGTTTCCATTGTTCCAAGCTCAAAGTCGATGAAGTATGTATCTACCATTGAAAATAGCGTGTTTTTATACTCATTATTGCCTCTAGACAAATCCTCGTTTCGAAAGAGCAAAGAAAATTACCGACTCAAAAGCTAAACTGCGTGCAGTATGGGACCTCGCCAAAGCCAAGATGACTTGTGAAGGCAGTGACGAAGCTGAAGGTGGTTTAGAAGAAAAGGAAGAGTTTGACAATGGCAAGCGCAAGAGTACACACGGCGGCTGCGGCTACAAACAACCTCTCATTCGCAAGGATGGCTTGAAATTGTACGCTCAGTTTCGTGCTAGTCCAGGAGATGTAAGTAGTGGTTGAGAGTTTTATGGTATTCATCGAGTTAACAGACAACCACATTAGGACTCTGGCAATGAAGGAAGACAACAGCTGACTGCTGCCAAAGTACTGCAAATCCTCAAGAACATTTCTGACAAGGATATTCGTGATATGGGCTTATCTGAAGAGTTTGCTCGCCCTGAATGGATGATTACAACTGTCTTACCTGTGCCTCCACCTCAAGTGCGTCCCTCTATTCAAATGGATGGTACCAGTCGCGGTGAAGATGATTTGACTCACAAATTGTCTGACGTTCTCAAGGCAAATGGCAATGTAAAGCGTTGTGAATCAGAAGGTGCTCCCGTACACGTTGTTCAAGAATTTGAGCAGCTCTTGCAGGTTTGTTAATATTGAATTGGATTGATTGATCCGTATTTTTTATTAAATACATATGCAACACACAGTTCCATATTGC

Morphology After 5 days on Potato dextrose medium at 25°C, colony is low, powdery, dark grey; reverse uncolored. Sporangia are grey, ovoid, columellate, stipes pigmented. Sporangiospores are grey, smooth-walled, irregularly shaped.
Name of Depositor L Ketch
Isolation
soil from mound of termites, Odontotermes sp., Mahale Mountains National Park, Tanzania
References

Laurie Ketch, personal communication

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation