Cladosporium cladosporioides (Fresenius) de Vries, anamorph (ATCC® 201654)

Strain Designations: ND89-19  /  Product Format: frozen

Deposited As Pyrenophora teres (Diedicke) Drechsler, teleomorph
Strain Designations ND89-19
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Highly virulent
Morphology On V8 medium at 20°C after 4 days, mycelium white becoming olive green, velutinous, semi-appressed. Reverse dark green to black. Hypahe dematiacous, guttulate. Conidia brownish green, smooth, both globose to lemon-shaped, 3.75-7.5 X 2.5-3.75 µm, and elongated ellipsoidal, 8.75-15 X 2.5-3.75 µm.
Medium Medium 343: V8 juice agar
Growth Conditions
Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACAAGTGACCCCGGTCTTACCACCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAGTAACCACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGGAAAGGTGCTCTATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGATAAGACTTGAGGAATGTAGCTCCCTCGGGAGTGTTATAGCCTCTTGTGATGCAGCGAGCGCCGGGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAATCCG

Morphology On V8 medium at 20°C after 4 days, mycelium white becoming olive green, velutinous, semi-appressed. Reverse dark green to black. Hypahe dematiacous, guttulate. Conidia brownish green, smooth, both globose to lemon-shaped, 3.75-7.5 X 2.5-3.75 µm, and elongated ellipsoidal, 8.75-15 X 2.5-3.75 µm.
Name of Depositor BJ Steffenson
Isolation
Barley leaves, Hordeum vulgare, Wales, ND
References

Steffenson BJ, et al. Genetics of seedling and adult plant resistance to net blotch (Pyrenophora teres f. teres) and spot blotch (Cochliobolus sativus) in barley. Theor. Appl. Genet. 92: 552-558, 1996.

Brian J Steffenson, personal communication