Geotrichum citri-aurantii (Ferraris) Butler, anamorph (ATCC® 201505)

Alternate State: Galactomyces citri-aurantii Butler, teleomorph  /  Strain Designations: Tm2  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Geotrichum candidum Link : Persoon, anamorph
Strain Designations Tm2
Alternate State Galactomyces citri-aurantii Butler, teleomorph
Application
physiological characterization
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Race
citrus race
Comments
Treatment with alcohols or citral inhibits arthrospore germination.
physiological characterization
Morphology After 5 days at 25°C colonies whitish and butyrous producing abundant sympodial and arthric conidia.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 307: Cornmeal agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

AAATCAAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACCTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCTTTTCTAAAATATCGAAACAAAATTGTTTGTAACAAAAATCATTCAACCTCAGATCAAGTAGGACTACCCGCTGAACTTAAGCATATCAA

D1/D2 region of 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCAACAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAATACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAAATTCCTTCTAAAGCTAAATATTGACGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACGTGGTGTTGTTGTTCAGCATTGTTTCGGCAGTGTGTATTCAACAATACTAGGCCAAGGTGGGGTGATTGGGAGTGAAAAAGAAGTAGGAATGTAGCTCCTCGGAGTGTTATAACCTACTTTCATAACTCCTTAGTCGCCTCAGGACTGCGCTTCGGCAAGGACTTTGGCATAATGATTCTATACCGC

Morphology After 5 days at 25°C colonies whitish and butyrous producing abundant sympodial and arthric conidia.
Name of Depositor DN Suprapta
Isolation
tomato field soil, Miyazaki, Japan
References

Suprapta DN, et al. Effects of volatile compounds on arthrospore germination and mycelial growth of Geotrichum candidum citrus race. Mycoscience 38: 31-35, 1997.

Suprapta DN, et al. Some physiological properties of citrus and noncitrus races of Geotrichum candidum isolated from soil in Japan. Mycoscience 37: 401-407, 1996.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation