Pestalotiopsis sp. (ATCC® 11816)

Strain Designations: QM531 [Pan H5 F1A]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Pestalotia royenae (Saccardo) Steyaert, anamorph
Strain Designations QM531 [Pan H5 F1A]
Application
produces carbomycin derivatives magnamycin derivatives
produces leucomycin derivatives
produces niddamycin derivatives
produces steroids
production of oxygenated steroids
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Morphology On PDA media at 25°C after 8 days, mycelium creamy white to tan, cottony in patches, becoming darker with age as conidia develop. Hyphae hyaline, guttulate. Conidia hyaline becoming reddish brown with age, segmented, sometimes bent, with 1-4 appendages, 13.5-16.5 X 6 µm.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AGGGATCATTATAGAGTTTTCTAAACTCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTATGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTATAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAACCCCCAATTTTTTGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA

 

D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTATAGCCTGTTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCA

Morphology On PDA media at 25°C after 8 days, mycelium creamy white to tan, cottony in patches, becoming darker with age as conidia develop. Hyphae hyaline, guttulate. Conidia hyaline becoming reddish brown with age, segmented, sometimes bent, with 1-4 appendages, 13.5-16.5 X 6 µm.
Name of Depositor Chas. Pfizer & Co., Inc.
Chain of Custody
ATCC <-- Chas. Pfizer & Co., Inc. <-- QM 531
Isolation
textile sample, Panama
References

Theriault RJ. Mycarosyl macrolide antibiotics. US Patent 3,784,447 dated Jan 8 1974

Shull GM, et al. Oxygenation of steroids in the 11-position. US Patent 2,721,163 dated Oct 18 1955

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation