Zygosaccharomyces siamensis Saksinchai et al. (ATCC® 10685)

Strain Designations: NRRL Y-1601 [CBS 684]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Zygosaccharomyces mellis-acidi von Richter, teleomorph
Strain Designations NRRL Y-1601 [CBS 684]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence:

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGAATGAAAAAAAGTTCGAAGAGCAGGATGAAGCAAGAGGGGGGAGTGAGGAAAACGAGGTAGAGAGGGGGTGATTTGGGGGACCTGCGCTTAGTTGCGCGGCTCCTGGGTCGCTTGTTTTTCTGCCTGGTATGCGTTGCCCTTGTGTGATGCGCTTTGCTCTCTTTTTTTCTTTGTCCGCCTTTGATTACACACGGTGGAGTTTCTGCTTTTATTGATGGCTTTGGGGGATGGGGAGAGCGTGAGGATGTCTTGTTCCTTTCGTATCTCTCTCGTCCCCCAGAGGTAAACACAAACAAGATTTTTCATGATACACAGCCAGTCAAAACAGAATTCGAGAAACGAATTTAGCAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAACTGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACGCTTGCGTTTGGTAGTGAGCGATACTCTATCTGACCTGACCCCCCCCGACCTGGGCGACTGGGGAGAGGGGAGCAGGAAGTGGAGTTTGCTTGAAAGTGGGAGGCCATAGACGGAGCTTAGCTTGAGTGCGCAGTTGAAGCTGCGACGCCTGGCCGCGAAAACGAAGTCGTATTAGGTTTTACCGACTCGGCGAAGGAAGTAGTGGACGGGGGGAAAAGAGCAGAGCTTTTTTGCTGGCTTGACAGAATTCTCAAAGTTTGACCTCAAATCAGGTAGGATTAC

 

D1D2 region of the 26S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGTACCATTCGGTGCCCGAGTTGTAATTTGGAGAGAGCGATTCTGGGGCTGGCGCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGATGTACCAGTTCTTTGTAGAGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGAGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGGACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGTGGCAGGAGAAAGCCTCGGGAATGTGACTCTTGCCTTTTTGGCGGGGGTGTTATAGCCCGAGGGGAATACTGCCAGCCGGGACTGAGGTATGCGACTCTCGTAGTCAAGGATGTTGGCATAATGGTTATATGCCGC

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- CBS 684 <-- CLMR <-- A.A. von Richter
Isolation
honey
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation