Penicillium rubens Biourge (ATCC® 9179)

Strain Designations: NRRL 832 [ATCC 7813, B 69, CBS 197.46, IMI 17968, QM 940]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium notatum Westling, anamorph
Strain Designations NRRL 832 [ATCC 7813, B 69, CBS 197.46, IMI 17968, QM 940]
Application
produces penicillin
produces phosphogluconate dehydrogenase 6-phosphogluconate dehydrogenase
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments Prototype strain for production of penicillin in submerged culture

The strain was reclassified as Penicillium rubens based on a recent molecular phylogenetic study RefHoubraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 312: Czapek's agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typcial aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


Beta-tubulin (TUB2) gene, partial sequence

GATCCCCTCCAGACGCGTCTTTTGTTTTCATATGGCCCCTGAGCCACGACCCCACCCCCAACAGATCTTTTGCTAACTTGCTCTAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTTCAACATGGAACATTCTTGGAAACATTCTTCGATTCGTGGGACTAAACTGGAATTGGGTTATAGGGTAACCAAATTGGTGCCGCTTTCTGGTAAGTCTCGGAGCTTTTTTTTTCGCGTTGGGTATCAATTGACAAGTTGCTAACTGGATTACAGGCAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGTTTAACAGTGATAGGGATTCTGGTGGATCACACGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACTGGGAATCGATTGATTGTGCATCATCTGATCGGACGTTTTTCTTTGACAATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGATGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACT

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- C Thom B 69
Isolation
Contaminant in culture labeled 'P. lacticus Maze & Perrier' from Ph. Biourge 69, Washington, DC
References

Houbraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767

Miller HM, Shepherd MG. Purification and properties of 6-phosphogluconate dehydrogenase from Penicillium duponti and Penicillium notatum. Can. J. Microbiol. 18: 1289-1298, 1972. PubMed: 5052896

Moyer AJ, Coghill RD. Penicillin. IX. The laboratory scale production of penicillin in submerged cultures by Penicillium notatum Westling (NRRL 832). J. Bacteriol. 51: 79-93, 1946.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation