Candida parapsilosis (Ashford) Langeron et Talice, anamorph (ATCC® 90018)

Strain Designations: 7312/52.493  /  Product Format: freeze-dried

Strain Designations 7312/52.493
Application
Quality control strain
Susceptibility testing
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing. For additional information, see CLSI M27-A2 (Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standards-Second Edition).
Morphology After 2 days on YM at 25°C, colonies are white, smooth, butyrous. Yeast cells are globose or ellipsoidal, single, in pairs or small clusters. Pseudohyphae not observed.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions Temperature: 25°C to 35°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACAGAATGAAAAGTGCTTAACTGCATTTTTTCTTACACATGTGTTTTTCTTTTTTTGAAAACTTTGCTTTGGTAGGCCTTCTATATGGGGCCTGCCAGAGATTAAACTCAACCAAATTTTATTTAATGTCAACCGATTATTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCTTGAAAGAAAGGCGGAGTATAAACTAATGGATAGGTTTTTTCCACTCATTGGTACAAACTCCAAAACTTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGATAAGTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCGC

Morphology After 2 days on YM at 25°C, colonies are white, smooth, butyrous. Yeast cells are globose or ellipsoidal, single, in pairs or small clusters. Pseudohyphae not observed.
Name of Depositor A Espinel-Ingroff
Isolation
Blood, Virginia
Cross References

Nucleotide (GenBank) : AX109693 Sequence 426 from Patent WO0123604.

Nucleotide (GenBank) : AX109739 Sequence 472 from Patent WO0123604.

References

Davey KG, et al. Comparative evaluation of FUNGITEST and broth microdilution methods for antifungal drug susceptibility testing of Candida species and Cryptococcus neoformans. J. Clin. Microbiol. 36: 926-930, 1998. PubMed: 9542910

Espinel-Ingroff A, et al. Collaborative comparison of broth macrodilution and microdilution antifungal susceptibility tests. J. Clin. Microbiol. 30: 3138-3145, 1992. PubMed: 1452697

Espinel-Ingroff A, et al. Comparison of two alternative microdilution procedures with the National Committee for Clinical Laboratory Standards reference macrodilution method M27-P for in vitro testing of fluconazole-resistant and -susceptible isolates of Candida albicans. J. Clin. Microbiol. 33: 3154-3158, 1995. PubMed: 8586692

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Pfaller MA, et al. Comparative evaluation of alternative methods for broth dilution susceptibility testing of fluconazole against Candida albicans. J. Clin. Microbiol. 32: 506-509, 1994. PubMed: 8150963

Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J. Clin. Microbiol. 32: 1650-1653, 1994. PubMed: 7929752