Cryptococcus neoformans (Sanfelice) Vuillemin (ATCC® 66031)

Alternate State: Filobasidiella neoformans Kwon-Chung  /  Strain Designations: AmMS 229  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Cryptococcus neoformans (Sanfelice) Vuillemin, anamorph
Strain Designations AmMS 229
Alternate State Filobasidiella neoformans Kwon-Chung
Application
Quality control strain
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Morphology Colonies white to cream-colored, mucoid, with entire margins. Cells globose-ovoid, reproducing by budding, in a few cases generating straight or branched chains of cells (sometimes elongate), ("pseudohyphae"). True septate hyphae produced under some conditions (by diploid strains).
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAAG

Morphology Colonies white to cream-colored, mucoid, with entire margins. Cells globose-ovoid, reproducing by budding, in a few cases generating straight or branched chains of cells (sometimes elongate), ("pseudohyphae"). True septate hyphae produced under some conditions (by diploid strains).
Name of Depositor GJ De Leon
Isolation Not available
Cross References

Nucleotide (GenBank) : EU240002 ITS including 5.8S rRNA gene

References

MicroScan Yeast ID QC Set. Dade/Siemens.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation