Candida lyxosophila Van der Walt et al. (ATCC® MYA-4685™)

Strain Designations: CBS 8194 [CCY 29-173-1, JCM 7532]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations CBS 8194 [CCY 29-173-1, JCM 7532]
Application
ferments xylose
Bioethanol production
Biosafety Level 1
Product Format frozen
Type Strain yes
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
      >D1D2 sequence for MYA-4685

        ACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGGTTGGCTCTTGTCTATGTTCCTTGGAAAAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGAAGCCCGATCCCGTGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTCTTTGCTTTCGGGCGGGGGCCTCTGCAGCTTACTGGGCCAGCATCGGTTTGGGTGGTAGGACAATTGCGGAGGAATGTGGCACCGCTTCGGTGGTGTGTTATAGCCTCTGTGGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTACGACTAGGATGCTGGCATAATGATCCTAAGCCGCCCGT
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- JP van der Walt
Isolation
Surface soil of woodland, Southern Africa.
Cross References

Nucleotide (GenBank) : HQ876049 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ876039 18S rRNA gene

References

Van der Walt JP, Ferreira NP, Steyn RL. Candida lyxosophila sp. nov., a new D-xylose fermenting yeast from Southern Africa. Antonie van Leeuwenhoek 53: 93-97, 1987.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS