Candida lyxosophila Van der Walt et al. (ATCC® MYA-4685)

Strain Designations: CBS 8194 [CCY 29-173-1, JCM 7532]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 8194 [CCY 29-173-1, JCM 7532]
Application
Ferments xylose
Bioethanol production
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGGTTGGCTCTTGTCTATGTTCCTTGGAAAAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGAAGCCCGATCCCGTGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTCTTTGCTTTCGGGCGGGGGCCTCTGCAGCTTACTGGGCCAGCATCGGTTTGGGTGGTAGGACAATTGCGGAGGAATGTGGCACCGCTTCGGTGGTGTGTTATAGCCTCTGTGGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTACGACTAGGATGCTGGCATAATGATCCTAAGCCGC

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- JP van der Walt
Isolation
Surface soil of woodland, Southern Africa.
Cross References

Nucleotide (GenBank) : HQ876049 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ876039 18S rRNA gene

Nucleotide (GenBank) : KC507448 EF-1 alpha gene

Nucleotide (GenBank) : KC507417 RPB1 gene

Nucleotide (GenBank) : KC512842 RPB2 gene

References

Van der Walt JP, Ferreira NP, Steyn RL. Candida lyxosophila sp. nov., a new D-xylose fermenting yeast from Southern Africa. Antonie van Leeuwenhoek 53: 93-97, 1987.

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation