Neofusicoccum australe (Slippers et al.) Crous et al. (ATCC® 60344)

Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Botryosphaeria dothidea (Mougeot : Fries) Cesati et De Notaris, teleomorph
Synonym Botryosphaeria australis Slippers et al
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium Medium 334: Oatmeal agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data

>ITS of ATCC 60344 GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTTGATTCGAGCTCCGGCTCGACTCTCCCACCCCATGTGTACCTACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGACCCCCGTTCGGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAACTCCAGTCAGTAAACGTCGCAGTCTGAGAAACAAGTTAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCTCCGTCCTCCGCGGACGCGCCTCGAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGAAAACACCTCGCTTTGGAGCGCATGGCGTCGCCCGCCGGACGAACCTTTGAATTTTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

//

>D1/D2 of 28S rRNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCTCGGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGACGGCTCCTGCCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGTGGGCTGCCTTAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTGGGGAATGTAGCTCCTCTCGGGGAGTGTTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCGGCTAGGATGCTGGCGTAATGGCTGTAAGCGGC

//

Name of Depositor J Worrall
Isolation
Sequoiadendron giganteum, California
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation