Candida norvegensis (Dietrichson) van Uden et Farinka ex van Uden et Buckley, anamorph (ATCC® 20686)

Alternate State: Pichia norvegensis Leask et Yarrow, teleomorph  /  Strain Designations: MF-56  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations MF-56
Alternate State Pichia norvegensis Leask et Yarrow, teleomorph
Application
produces ascorbic acid vitamin C
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology

After 5 days at 25°C growth is yellowish–white, smooth, glistening and butyrous. Cells are globose to ellipsoidal, (1.7- 4.1) x (3.0-10.0) µm.

Growth Conditions
Temperature: 30.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ACTTCTTTCTTACACCGCGTGAGCGCACAACAACACCTAAACACGAATAACCATGTCACCCAGAGAAAATCTCAAACGAGAAGAAAGAAAAAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCTCCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCTTCTTGCGCAAGCAGAGTTGGGGTTGCCACGGCCCGTGCGGCCTGTGTGTGGCTCCCCCGAAACGGAACGGCAGCGGGACTGAGCGAAGTACACAACACTCGCGCTTGGCCCGCCGAACTTTTTTTTTAAATCTAAGCTCGAC.

Large subunit ribosomal RNA gene, partial sequence.

ACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGCAGCGGCAACGCAGCGAGTTGTAGATTGCAGGTGGGAGAGTTTGCGGGCGGCGGGCGTCGAAGTCCCTTGGAACAGGGCGCCACTGAGGGTGAGAGCCCCGTGCGATGCCTGCCCATGCTTTGAACTCCCCTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGAATCGCGCACCGCTGCTCCTCGTGGGCGGCGCTCTGCGCTTTTCCTGGGCCAGCATCGGTTTCCGCTGCAGGAGAAGGGGCTGTGGAATGTGGCTGGCACGCTTGCGCGCCAGTGTTATAGCCACGGGCCAGATGCTGCGTGTGGGGACCGAGGGCTGCGACGGCAACGTCTCGGATGCTGGCAC

Morphology

After 5 days at 25°C growth is yellowish–white, smooth, glistening and butyrous. Cells are globose to ellipsoidal, (1.7- 4.1) x (3.0-10.0) µm.

Name of Depositor Kraft Inc.
Isolation
derived from CBS 2145
Cross References

Nucleotide (GenBank) : JQ070172 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070096 ITS including 5.8S rRNA gene

References

Roland JF, et al. Fermentation production of ascorbic acid from L-galactonic substrate. US Patent 4,595,659 dated Jun 17 1986

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation