pJFCAT1 (ATCC® 77317)

Applications: promoter-cloning vectorreporter constructshuttle vectorvector containing primer sites useful for sequencingvector permitting production of single-stranded DNA  /  Depositors: JL Fridovich-Keil

Designations pJFCAT1
Depositors JL Fridovich-Keil
Biosafety Level 1
Vector Information
Size (kb): 5.5000000000000000
Vector: pJFCAT1 (phagemid)
Construction: pBLCAT3, pUCf1, SV40 poly(A)
Marker(s):ampR
Construct size (kb): 5.5
Features: insert detection: CAT
marker(s): ampR
replicon: pMB1, f1
terminator: SV40
Applications
promoter-cloning vector
reporter construct
shuttle vector
vector containing primer sites useful for sequencing
vector permitting production of single-stranded DNA
Comments
Restriction digests of the clone give the following sizes (kb): HindIII--5.0, 0.75; EcoRI/HindIII--2.7, 2.0, 0.75, 0.3; XhoI--5.8.
A promoter/enhancer-cloning shuttle vector using chloramphenicol acetyltransferase (CAT) as the reporter gene.
The KpnI and SstI sites can be used for cloning enhancer elements.
To avoid potential problems using primer 2, try the following primer sequence instead (assumes promoter inserted at or downstream of the SphI site): 5' TTATCATGTCTGGATCCAAG 3'
Promoter elements cloned into the polylinker may be sequenced using the following oligonucleotide primers. primer 1: 5'-TCCTTAGCTCCTGAAAATCT- 3'; primer 2: 5'-AAACTCATCAATGTATCTTA- 3'.
Contains a trimer cassette of the SV40 major late polyadenylation signal to block background readthrough expression of the reporter gene.
The order of the major features in this phagemid is : HindIII - SV40 polyadenylation trimer - primer 2 site - BamHI/MCS/XhoI - primer 1 site - CAT gene - SV40 splice and polyadenylation signal - f1 ori - KpnI - SstI - ampR/pUC18.
Media ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin
Growth Conditions
Temperature: 37.0°C
References

Fridovich-Keil JL, et al. Improved expression vectors for eukaryotic promoter/enhancer studies. BioTechniques 11: 572-579, 1991. PubMed: 1725108

Judith L Fridovich-Keil, personal communication

Shipped freeze-dried
Product Sheet
Product Sheet
Product Sheet