Cryptococcus gattii (Vanbreus. et Takashio) Kwon-Chung et Boekhout, anamorph (ATCC® MYA-4877)

Alternate State: Filobasidiella bacillispora Kwon-Chung, teleomorph  /  Strain Designations: A6MR38 [CBS 11545]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations A6MR38 [CBS 11545]
Alternate State Filobasidiella bacillispora Kwon-Chung, teleomorph
Biosafety Level 2
Product Format frozen
Type Strain no
Genotype VGIIc; AFLP6C
Mating Type MATalpha
Comments
highly virulent novel genotype RefByrnes EJ III, et al. Emergence and pathogenicity of highly virulent Cryptococcus gattii genotypes in the Northwest United States. PLoS Pathog. 6: e1000850, 2010. PubMed: 20421942
Morphology On YM medium at 25°C after 6 days, colonies creamy white to pale yellow, mucoid. Cells globose to subglobose, smooth, contain oil droplets, 3-5.25 µm X 3-5.25 µm. Pseudohyphae not observed.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATACTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCAGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 28S ribosomal RNA gene:

ACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGACCCGTCTT

Morphology On YM medium at 25°C after 6 days, colonies creamy white to pale yellow, mucoid. Cells globose to subglobose, smooth, contain oil droplets, 3-5.25 µm X 3-5.25 µm. Pseudohyphae not observed.
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- K Bartlett, E Burne, F Hagen
Isolation
CSF of immunicompetent human, Oregon, USA
Cross References

Nucleotide (GenBank) : JQ812708 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ812702 D1/D2 region of LSU rRNA gene

References

MacDougall, L., et al. Spread of Cryptoccus gattii in British Columbia, Canada, and detection in the Pacific Northwest, USA. Emerg. Infect. Dis. 13(1): 42-50, 2007. PubMed: 17370514

Byrnes EJ III, et al. Emergence and pathogenicity of highly virulent Cryptococcus gattii genotypes in the Northwest United States. PLoS Pathog. 6: e1000850, 2010. PubMed: 20421942

Byrnes EJ III, et al. Molecular evidence that the Vancouver Island Cryptococcus gattii outbreak has expanded into the United States Pacific Northwest. J. Infect. Dis. 199: 1081-1086, 2009. PubMed: 19220140

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation