Candida albicans (Robin) Berkhout, anamorph (ATCC® MYA-574™) Strain Designations: Gu5 / Product Format: frozen General Information Characteristics Culture Method Specifications History Documentation Print Email Share Share this product Facebook Twitter Google+ Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Strain Designations Gu5 Biosafety Level 1 Product Format frozen Storage Conditions Frozen: -80°C or colderFreeze-Dried: 2°C to 8°C Type Strain no Comments fluconazole-resistant Morphology After 3 days, colonies cream-colored, smooth, dull, dome-shaped. Cells globose to short-ovoid, 2.0-7.0 x 3.0-8.5 µm, single or budding, occasionally forming short chains. Medium ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD Growth Conditions Temperature: 20°C to 25°CAtmosphere: Typical aerobic Sequenced Data D1D2 region of the 28S ribosomal RNA gene:AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTG Morphology After 3 days, colonies cream-colored, smooth, dull, dome-shaped. Cells globose to short-ovoid, 2.0-7.0 x 3.0-8.5 µm, single or budding, occasionally forming short chains. Name of Depositor J Morschhauser Special Collection NCRR Contract Isolation patient with AIDS, Germany; patient 3 References Franz R, et al. Molecular aspects of fluconazole resistance development in Candida albicans. Mycoses 42: 453-458, 1999. PubMed: 10546486 Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Basic Documentation Product Sheet Certificate of Analysis MSDS Other Documentation Microbial Characterization Data