Candida albicans (Robin) Berkhout, anamorph (ATCC® 64124)

Strain Designations: Darlington  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations Darlington
Application
Opportunistic pathogen research
Sexually Transmitted Disease Research
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Comments
Ketoconazole-resistant
Morphology After 3 days at 25°C colonies cream-colored, smooth, dull, dome-shaped, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells generally globose to short-ovoid, thin-walled, hyaline, single or budding, occasionally forming short chains.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGAA

Morphology After 3 days at 25°C colonies cream-colored, smooth, dull, dome-shaped, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells generally globose to short-ovoid, thin-walled, hyaline, single or budding, occasionally forming short chains.
Name of Depositor CF Vickers
Isolation
mouth swab
References

Hitchcock CA, et al. The lipid composition of azole-sensitive and azole-resistant strains of Candida albicans. J. Gen. Microbiol. 132: 2421-2431, 1986. PubMed: 3540203

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation