Candida albicans (Robin) Berkhout, anamorph (ATCC® 28121™) Strain Designations: 304 / Product Format: freeze-dried General Information Characteristics Culture Method Specifications History Documentation Print Email Share Share this product Facebook Twitter Google+ Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Strain Designations 304 Biosafety Level 1 Product Format freeze-dried Storage Conditions Frozen: -80°C or colderFreeze-Dried: 2°C to 8°C Type Strain no Comments Effect in guinea pig leucocytes Morphology Colonies are white to cream-colored, butyrous to membranous, entire to erose margins. Cells globose-ovoid-ellipsoid, reproducing by budding. Pseudohyphae present. Medium ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD Growth Conditions Temperature: 20°C to 25°CAtmosphere: Typical aerobic Sequenced Data D1D2 region of the 28S ribosomal RNA gene: AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGAAA Morphology Colonies are white to cream-colored, butyrous to membranous, entire to erose margins. Cells globose-ovoid-ellipsoid, reproducing by budding. Pseudohyphae present. Name of Depositor DH Howard Isolation feces, California References Howard DH. Fate of Histoplasma capsulatum in guinea pig polymorphonuclear leukocytes. Infect. Immun. 8: 412-419, 1973. PubMed: 4125783 Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Basic Documentation Product Sheet Certificate of Analysis MSDS Other Documentation Microbial Characterization Data