Aspergillus fumigatus Fresenius, anamorph (ATCC® 96918)

Strain Designations: SRRC 2006 [CBS 286.95, IMI 370079]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations SRRC 2006 [CBS 286.95, IMI 370079]
Application
Aspergillus reference strain for identification and morphological observation recommended by the International Commission on Penicillium and Aspergillus (ICPA)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Aspergillus reference strain for identification and morphological observation recommended by the International Commission on Penicillium and Aspergillus (ICPA)
Morphology Colonies after 3-4 days on Blakeslee malt extract agar at 25°C conidia grey turquoise to dark turquoise to dark green and mycelium white. Conidial heads columnar, strips smooth-walled expanding gradually into pyriform. Conidia globose to broadly ovoid, smooth to finely roughened or spinose.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCTGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC

Morphology Colonies after 3-4 days on Blakeslee malt extract agar at 25°C conidia grey turquoise to dark turquoise to dark green and mycelium white. Conidial heads columnar, strips smooth-walled expanding gradually into pyriform. Conidia globose to broadly ovoid, smooth to finely roughened or spinose.
Name of Depositor MA Klich
Cross References

Nucleotide (GenBank) : KC689328 ITS including 5.8S rRNA gene

References

Klich MA, et al. Aspergillus reference cultures. New Orleans and Baarn: International Commission on Penicillium and Aspergillus; 1996.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation