Aspergillus fumigatus var. ellipticus Raper et Fennell, anamorph (ATCC® 32820)

Strain Designations: NCMH 77  /  Product Format: freeze-dried

Strain Designations NCMH 77
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Albino variant.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 323: Malt agar medium
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor MR McGinnis
Isolation
Human paranasal aspergilloma, North Carolina
Cross References

Nucleotide (GenBank) : KC689318 ITS including 5.8S rRNA gene