Aspergillus fumigatus Fresenius, anamorph (ATCC® 1022)

Strain Designations: NRRL 163 [118, CBS 133.61, IMI 16152, LSHB Ac71, NCTC 982, QM 1981, WB 163]  /  Product Format: freeze-dried

Strain Designations NRRL 163 [118, CBS 133.61, IMI 16152, LSHB Ac71, NCTC 982, QM 1981, WB 163]
Application
Quality control strain
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology On PDA medium at 25°C after 22 days, mycelium are white becoming olive green, velutinous to cottony and the reverse is tan. The conidia are verrucose and olive green. The vesicles are sub-globose to clavate and 16.5 to 18 µm. The hyphae are hyaline.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CCCTTTGTACACACCGCCCGTCGCTACTACCGATTGAATGGCTCGGTGAGGCCTTCGGACTGGCTCAGGGGAGTTGGCAACGACTCCCCAGAGCCGGAAAGTTGGTCAAACCCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGG



D1D2 region of the 28S ribosomal RNA gene

CCAGCGTCCGAGCCGAAGCGCGTTCCTCGGTCCAGGCAGGCCGCATTGCACCCTCGGCTATAAGACACCCCGAGAGGTGATACATTCCGAGGGCCTTTGACCGGCCGCCCAAACCGACGCTGGCCCGCCCACGGGGAAGTACACCGGCACGAATGCCGGCTGAACCCCGCGGGCGAGTCTGGTCGCAAACGCTTCCCTTTCAACAATTTCACGTGCTGTTTAACTCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCCGGCCAGTATTTAGCTTTAGATGAAATTTACCACCCATTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGGACGCAGACACCCCGTCCCAGACGGGATTCTCACCCTCTATGACGGCCCGTTCCAGGGCACTTAGACGGGGGCTGCACCCGAAGCATCCTCTGCAAATTACAACGCGGACCCCGAAGGGGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAT

Morphology On PDA medium at 25°C after 22 days, mycelium are white becoming olive green, velutinous to cottony and the reverse is tan. The conidia are verrucose and olive green. The vesicles are sub-globose to clavate and 16.5 to 18 µm. The hyphae are hyaline.
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- C Thom 118
Isolation
Lung of chicken, Connecticut
Cross References

Nucleotide (GenBank) : HQ026746 ITS including 5.8S rRNA gene

References

Samson RA, Gams W. Typification of the species of Aspergillus and associated teleomorphs In Samson RA, Gams W. Advances in Penicillium and Aspergillus systematics. New York, Plenum Press pp. 31-54, 1985.

Applied Biosystems, MicroSeq Food Panel.