Trichophyton rubrum (Castellani) Sabouraud, anamorph (ATCC® MYA-4438)

Strain Designations: MRL 666  /  Product Format: frozen

Strain Designations MRL 666
Application
Susceptibility testing
Antifungal susceptibility testing RefGhannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. RefEspinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
keratinophilic dermatophyte
the most common cause of athlete's foot
Morphology After 4-5 days on Potato dextrose agar at 25°C colonies fluffy to cottony white, reverse yellow then turn to wine-red. Microconidia are clavate to pyriform, sessile alongside undifferentiated hyphae.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGACCGACGTTCCATCAGGGGTGAGCAGACGTGCGCCGGCCGTACGCCCCCATTCTTGTCTACCTCACCCGGTTGCCTCGGCGGGCCGCGCTCCCCCTGCCAGGGAGAGCCGTCCGGCGGGCCCCTTCTGGGAGCCTCGAGCCGGACCGCGCCCGCCGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAGCACAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCCCCTCCCTTCGGGGGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAGCCAATTCAGCGCCCTCAGGACCGGCCGCCCTGGCCCCAATCTTTATATATATATATATCTTTTCAGGTTGACCTCGGATCAGGTAGGG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGCGGCCCCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGGCGGGGTTCAGCGGGCGCTCGTCGCCCGTGCACTGCCCGCTCCCCGGGCCAGCATCAGCTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGAGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC

Morphology After 4-5 days on Potato dextrose agar at 25°C colonies fluffy to cottony white, reverse yellow then turn to wine-red. Microconidia are clavate to pyriform, sessile alongside undifferentiated hyphae.
Name of Depositor MA Ghannoum
Special Collection ATCC
Chain of Custody
ATCC <-- MA Ghannoum
Isolation
human toenail, USA
Cross References

Nucleotide (GenBank) : FJ746657 ITS including 5.8S rRNA gene

References

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi; Approved Standard. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A.

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.

Shehata AS, et al. Comparison between the standardized Clinical and Laboratory Standards Institute M38-A2 method and a 2,3-bis(2-methoxy-4-nitro-5-[(sulphenylamino)carbonyl]-2H-tetrazolium hydroxide- based method for testing antifungal susceptibility of dermatophytes. J. Clin. Microbiol. 46: 3668-3671, 2008.

Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.