Paecilomyces variotii Bainier, anamorph (ATCC® MYA-3630)

Strain Designations: 10831220  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations 10831220
Application
antifungal susceptibility testing
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Comments
Human pathogen.
The ITS and beta-tubulin sequences of MYA-3630 are identical to those of Hamigera insecticola type strain NRRL 35386 (GenBank EF634410 and GU092773). The species identity of this strain may need further investigation.
Morphology Colonies growing rapidly, powdery to floccose, funiculose or tufted, yellow-brown or sand colour.
Conidiophores with verticillately arranged branches, bearing phialides, up to 150 µm in length, 3.5-6.5 µm wide. Phialides cylindrical or ellipsoidal, tapering abruptly into a long, thin, cylindrical neck. Conidia subspherical, ellipsoidal to fusiform, hyaline to yellow, 3-5 x 2-4 µm, arising in long, divergent chains. Chlamydospores usually present.
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
Growth Conditions
Temperature: 25°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTCAGGCCGCCGGGGGGCGTCTCGCCCCCGGGCCCGCGCCCGCCGAAGACACCATCGAACGCTGTCTGAAGGTTGCCGTCTGAGTCGATTATCAAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCCGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGCAGGCCCGGCCGGCGCTGGCCGACAACCTTTTTTACTTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

ITS DNA sequence of this organism is identical to Hamigera sp.
Morphology Colonies growing rapidly, powdery to floccose, funiculose or tufted, yellow-brown or sand colour.
Conidiophores with verticillately arranged branches, bearing phialides, up to 150 µm in length, 3.5-6.5 µm wide. Phialides cylindrical or ellipsoidal, tapering abruptly into a long, thin, cylindrical neck. Conidia subspherical, ellipsoidal to fusiform, hyaline to yellow, 3-5 x 2-4 µm, arising in long, divergent chains. Chlamydospores usually present.
Name of Depositor MG Rinaldi
Special Collection NSF - Mycology
Chain of Custody
M G Rinaldi
Isolation
Connecticut, United States
Geographical Isolation Hartford Hospital
References

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation